Signal to Noise: A Critical Analysis of Active Information
| April 23, 2015 | Posted by johnnyb under Conservation of Information, Evolution, Intelligent Design, UD Guest Posts |
The following is a guest post by Aurelio Smith. I have invited him to
present a critique of Active Information in a more prominent place at
UD so we can have a good discussion of Active Information’s strengths
and weaknesses. The rest of this post is his.
My thanks to johnnyb for offering to host a post from me on the subject of ‘active information’. I’ve been following the fortunes of the ID community for some time now and I was a little disappointed that the recent publications of the ‘triumvirate’ of William Dembski, Robert Marks and their newly promoted postgrad Doctor Ewert have received less attention here than their efforts deserve. The thrust of their assault on Darwinian evolution has developed from earlier concepts such as “complex specified information” and “conservation of information” and they now introduce “Algorithmic Specified Complexity” and “Active information”.
Some history.
William Demsbski gives an account of the birth of his ideas here:
…in the summer of 1992, I had spent several weeks with Stephen Meyer and Paul Nelson in Cambridge, England, to explore how to revive design as a scientific concept, using it to elucidate biological origins as well as to refute the dominant materialistic understanding of evolution (i.e., neo-Darwinism). Such a project, if it were to be successful, clearly could not merely give a facelift to existing design arguments for the existence of God. Indeed, any designer that would be the conclusion of such statistical reasoning would have to be far more generic than any God of ethical monotheism. At the same time, the actual logic for dealing with small probabilities seemed less to directly implicate a designing intelligence than to sweep the field clear of chance alternatives. The underlying logic therefore was not a direct argument for design but an indirect circumstantial argument that implicated design by eliminating what it was not.*
[*my emphasis]
Dembski published The Design Inference in 1998, where the ‘explanatory filter’ was proposed as a tool to separate ‘design’ from ‘law’ and ‘chance’. The weakness in this method is that ‘design’ is assumed as the default after eliminating all other possible causes. Wesley Elsberry’s review points out the failure to include unknown causation as a possibility. Dembski acknowledges the problem in a comment in a thread at Uncommon Descent – Some Thanks for Professor Olofsson
I wish I had time to respond adequately to this thread, but I’ve got a book to deliver to my publisher January 1 — so I don’t. Briefly: (1) I’ve pretty much dispensed with the EF. It suggests that chance, necessity, and design are mutually exclusive. They are not. Straight CSI [Complex Specified Information] is clearer as a criterion for design detection.* (2) The challenge for determining whether a biological structure exhibits CSI is to find one that’s simple enough on which the probability calculation can be convincingly performed but complex enough so that it does indeed exhibit CSI. The example in NFL ch. 5 doesn’t fit the bill. The example from Doug Axe in ch. 7 of THE DESIGN OF LIFE (www.thedesignoflife.net) is much stronger. (3) As for the applicability of CSI to biology, see the chapter on “assertibility” in my book THE DESIGN REVOLUTION. (4) For my most up-to-date treatment of CSI, see “Specification: The Pattern That Signifies Intelligence” at http://www.designinference.com. (5) There’s a paper Bob Marks and I just got accepted which shows that evolutionary search can never escape the CSI problem (even if, say, the flagellum was built by a selection-variation mechanism, CSI still had to be fed in).
[*my emphasis]
Active information.
Dr Dembski has posted some background to his association with Professor Robert Marks and The Evolutionary Informatics Lab which has resulted in the publication of several papers with active information as an important theme. A notable collaborator is Winston Ewert Ph D, whose master’s thesis was entitled: Studies of Active Information in Search where, in chapter four, he criticizes Lenski et al., 2003, saying:
[quoting Lenski et al., 2003]“Some readers might suggest that we stacked the deck by studying the evolution of a complex feature that could be built on simpler functions that were also useful.”
This, indeed, is what the writers of Avida software do when using stair step active information.
What is active information?
In A General Theory of Information Cost Incurred by Successful Search, Dembski, Ewert and Marks (henceforth DEM) give their definition of “active information” as follows:
In comparing null and alternative searches, it is convenient to convert probabilities to information measures (note that all logarithms in the sequel are to the base 2). We therefore define the endogenous information IΩ as –log(p), which measures the inherent difficulty of a blind or null search in exploring the underlying search space Ω to locate the target T. We then define the exogenous information IS as –log(q), which measures the difficulty of the alternative search S in locating the target T. And finally, we define the active information I+ as the difference between the endogenous and exogenous information: I+ = IΩ – IS = log(q/p). Active information therefore measures the information that must be added (hence the plus sign in I+) on top of a null search to raise an alternative search’s probability of success by a factor of q/p. [excuse formatting errors in mathematical symbols]
They conclude with an analogy from the financial world, saying:
Conservation of information shows that active information, like money, obeys strict accounting principles. Just as banks need money to power their financial instruments, so searches need active information to power their success in locating targets. Moreover, just as banks must balance their books, so searches, in successfully locating targets, must balance their books — they cannot output more information than was inputted.
In an article at the Pandas Thumb website Professor Joe Felsenstein, in collaboration with Tom English, presents some criticism of of the quoted DEM paper. Felsenstein helpfully posts an “abstract in the comments, saying:
Dembski, Ewert and Marks have presented a general theory of “search” that has a theorem that, averaged over all possible searches, one does not do better than uninformed guessing (choosing a genotype at random, say). The implication is that one needs a Designer who chooses a search in order to have an evolutionary process that succeeds in finding genotypes of improved fitness. But there are two things wrong with that argument: 1. Their space of “searches” includes all sorts of crazy searches that do not prefer to go to genotypes of higher fitness – most of them may prefer genotypes of lower fitness or just ignore fitness when searching. Once you require that there be genotypes that have different fitnesses, so that fitness affects their reproduction, you have narrowed down their “searches” to ones that have a much higher probability of finding genotypes that have higher fitness. 2. In addition, the laws of physics will mandate that small changes in genotype will usually not cause huge changes in fitness. This is true because the weakness of action at a distance means that many genes will not interact strongly with each other. So the fitness surface is smoother than a random assignment of fitnesses to genotypes. That makes it much more possible to find genotypes that have higher fitness. Taking these two considerations into account – that an evolutionary search has genotypes whose fitnesses affect their reproduction, and that the laws of physics militate against strong interactions being typical – we see that Dembski, Ewert, and Marks’s argument does not show that Design is needed to have an evolutionary system that can improve fitness.
I note that there is an acknowledgement in the DEM paper as follows:
The authors thank Peter Olofsson and Dietmar Eben for helpful feedback on previous work of the Evolutionary Informatics Lab, feedback that has found its way into this paper.
This is the same Professor Olofsson referred to in the “Some Thanks for Professor Olofsson“ thread mentioned above. Dietmar Eben has blogged extensively on DEM’s ideas.
I’m not qualified to criticize the mathematics but I see no need to doubt that it is sound. However what I do query is whether the model is relevant to biology. The search for a solution to a problem is not a model of biological evolution and the concept of “active information” makes no sense in a biological context. Individual organisms or populations are not searching for optimal solutions to the task of survival. Organisms are passive in the process, merely affording themselves of the opportunity that existing and new niche environments provide. If anything is designing, it is the environment. I could suggest an anthropomorphism: the environment and its effects on the change in allele frequency are “a voice in the sky” whispering “warmer” or “colder”. There is the source of the active information.
I was recently made aware that this classic paper by Sewall Wright, The Roles of Mutation, Inbeeding, Crossbreeding and Selection in Evolution, is available online. Rather than demonstrating the “active information” in Dawkins’ Weasel program, which Dawkins freely confirmed is a poor model for evolution with its targeted search, would DEM like to look at Wright’s paper for a more realistic evolutionary model?
Perhaps, in conclusion, I should emphasize two things. Firstly, I am utterly opposed to censorship and suppression. I strongly support the free exchange of ideas and information. I strongly support any genuine efforts to develop “Intelligent Design” into a formal scientific endeavor. Jon Bartlett sees advantages in the field of computer science and I say good luck to him. Secondly, “fitness landscape” models are not accurate representations of the chaotic, fluid, interactive nature of the real environment . The environment is a kaleidoscope of constant change. Fitness peaks can erode and erupt. Had Sewall Wright been developing his ideas in the computer age, his laboriously hand-crafted diagrams would, I’m sure, have evolved (deliberate pun) into exquisite computer models.
References
History: Wm Dembski 1998 the Design inference, explanatory filter ( Elsberry criticizes the book for using a definition of “design” as what is left over after chance and regularity have been eliminated)
Wikipedia, upper probability bound, complex specified information, conservation of information, meaningful information.
Theft over Toil John S. Wilkins, Wesley R. Elsberry 2001
Computational capacity of the universe Seth Lloyd 2001
Information Theory, Evolutionary Computation, and
Dembski’s “Complex Specified Information” Elsberry and Shallit 2003
Specification: The Pattern That Signifies Intelligence by William A. Dembski August 15, 2005
Evaluation of Evolutionary and Genetic
Optimizers: No Free Lunch Tom English 1996
Conservation of Information Made Simple William Dembski 2012
…evolutionary biologists possessing the mathematical tools to understand search are typically happy to characterize evolution as a form of search. And even those with minimal knowledge of the relevant mathematics fall into this way of thinking.
Take Brown University’s Kenneth Miller, a cell biologist whose knowledge of the relevant mathematics I don’t know. Miller, in attempting to refute ID, regularly describes examples of experiments in which some biological structure is knocked out along with its function, and then, under selection pressure, a replacement structure is evolved that recovers the function. What makes these experiments significant for Miller is that they are readily replicable, which means that the same systems with the same knockouts will undergo the same recovery under the same suitable selection regime. In our characterization of search, we would say the search for structures that recover function in these knockout experiments achieves success with high probability.
Suppose, to be a bit more concrete, we imagine a bacterium capable of producing a particular enzyme that allows it to live off a given food source. Next, we disable that enzyme, not by removing it entirely but by, say, changing a DNA base in the coding region for this protein, thus changing an amino acid in the enzyme and thereby drastically lowering its catalytic activity in processing the food source. Granted, this example is a bit stylized, but it captures the type of experiment Miller regularly cites.
So, taking these modified bacteria, the experimenter now subjects them to a selection regime that starts them off on a food source for which they don’t need the enzyme that’s been disabled. But, over time, they get more and more of the food source for which the enzyme is required and less and less of other food sources for which they don’t need it. Under such a selection regime, the bacterium must either evolve the capability of processing the food for which previously it needed the enzyme, presumably by mutating the damaged DNA that originally coded for the enzyme and thereby recovering the enzyme, or starve and die.
So where’s the problem for evolution in all this? Granted, the selection regime here is a case of artificial selection — the experimenter is carefully controlling the bacterial environment, deciding which bacteria get to live or die*. [(* My emphasis) Not correct – confirmed by Richard Lenski – AF] But nature seems quite capable of doing something similar. Nylon, for instance, is a synthetic product invented by humans in 1935, and thus was absent from bacteria for most of their history. And yet, bacteria have evolved the ability to digest nylon by developing the enzyme nylonase. Yes, these bacteria are gaining new information, but they are gaining it from their environments, environments that, presumably, need not be subject to intelligent guidance. No experimenter, applying artificial selection, for instance, set out to produce nylonase.
To see that there remains a problem for evolution in all this, we need to look more closely at the connection between search and information and how these concepts figure into a precise formulation of conservation of information. Once we have done this, we’ll return to the Miller-type examples of evolution to see why evolutionary processes do not, and indeed cannot, create the information needed by biological systems. Most biological configuration spaces are so large and the targets they present are so small that blind search (which ultimately, on materialist principles, reduces to the jostling of life’s molecular constituents through forces of attraction and repulsion) is highly unlikely to succeed. As a consequence, some alternative search is required if the target is to stand a reasonable chance of being located. Evolutionary processes driven by natural selection constitute such an alternative search. Yes, they do a much better job than blind search. But at a cost — an informational cost, a cost these processes have to pay but which they are incapable of earning on their own.
Meaningful Information
Meaningful Information Paul Vit´anyi 2004
The question arises whether it is possible to separate meaningful information from accidental information, and if so, how.
Evolutionary Informatics Publications
Conservation of Information in Relative Search Performance Dembski, Ewert, Marks 2013
Algorithmic Specified Complexity
in the Game of Life Ewert, Dembski, Marks 2015
Digital Irreducible Complexity: A Survey of Irreducible
Complexity in Computer Simulations Ewert 2014
On the Improbability of Algorithmic Specified
Complexity Dembski, Ewert, Marks 2013
Wikipedia, upper probability bound, complex specified information, conservation of information, meaningful information.
A General Theory of Information Cost Incurred by Successful Search Dembski, Ewert, Marks 2013
Actually, in my talk, I work off of three papers, the last of which Felsenstein fails to cite and which is the most general, avoiding the assumption of uniform probability to which Felsenstein objects.
Dieb review “cost of successful search”
Conservation of Information in Search:
Measuring the Cost of Success Dembski, Marks 2009
The Search for a Search: Measuring the Information Cost of
Higher Level Search Dembski, Marks 2009
Has Natural Selection Been Refuted? The Arguments of William Dembski Joe Felsenstein 2007
In conclusion
Dembski argues that there are theorems that prevent natural selection from explaining the adaptations that we see. His arguments do not work. There can be no theorem saying that adaptive information is conserved and cannot be increased by natural selection. Gene frequency changes caused by natural selection can be shown to generate specified information. The No Free Lunch theorem is mathematically correct, but it is inapplicable to real biology. Specified information, including complex specified information, can be generated by natural selection without needing to be “smuggled in”. When we see adaptation, we are not looking at positive evidence of billions and trillions of interventions by a designer. Dembski has not refuted natural selection as an explanation for adaptation.
ON DEMBSKI’S LAW OF CONSERVATION OF INFORMATION Erik Tellgren 2002
611 Responses to Signal to Noise: A Critical Analysis of Active Information
Leave a Reply
You must be logged in to post a comment.
Many thanks to Aurelio Smith for taking the time to write this! I have my own comments on it, but wanted to open it up first to see what UD readers thought about Aurelio’s criticism, and if they had their own criticisms of Active Information. Looking forward to the discussion!
I’m particularly interested in how specified complexity and active information “live together” in ID theory. But I don’t want to derail the discussion with my preoccupation. What I hope for now is that you’ll accept my promise to behave well, and allow my comments to appear without delay.
Apologies, as this is not a comment directly about information. But Aurelio Smith writes:
Darwin orginally saw species’ random variation as being tuned progressively to a more or less uniform environment. Even now, the environment is seen as the non-random factor acting on random variations that enable it to be the substitute for a designer.
But a “kaleidoscope of constant change” is at least as random as mutations are supposed to be. If it is true, what factor in the theory of evolution can possibly give it the prolonged trajectories we see – which alone enable it to be represented as a tree?
To extend his analogy – mutations are a kaleidoscope of random change, and appear in an environment which is a kaleidoscope of random change. There is nothing in that scenario leading one to expect a picture to appear, still less to persist.
http://www.evolutionnews.org/2.....63671.html
The work of Douglas Axe et al. provides empirical confirmation of the the roughness of the fitness landscape.
http://www.evolutionnews.org/2.....92941.html
F/N: Pardon a clip from my longstanding online note accessible via my handle, Sect A. Pardon also what I judge to be necessary length in the clip:
______________
>> . . . let us now consider in a little more detail a situation where an apparent message is received. What does that mean? What does it imply about the origin of the message . . . or, is it just noise that “got lucky”?
* If an apparent message is received, it means that something is working as an intelligible — i.e. functional — signal for the receiver. In effect, there is a standard way to make and send and recognise and use messages in some observable entity [e.g. a radio, a computer network, etc.], and there is now also some observed event, some variation in a physical parameter, that corresponds to it. [For instance, on this web page as displayed on your monitor, we have a pattern of dots of light and dark and colours on a computer screen, which correspond, more or less, to those of text in English.]
* Information theory, as Fig A.1 [an amplified version of the Shannon system diagram] illustrates, then observes that if we have a receiver, we credibly have first had a transmitter, and a channel through which the apparent message has come; a meaningful message that corresponds to certain codes or standard patterns of communication and/or intelligent action. [Here, for instance, through HTTP and TCP/IP, the original text for this web page has been passed from the server on which it is stored, across the Internet, to your machine, as a pattern of binary digits in packets. Your computer then received the bits through its modem, decoded the digits, and proceeded to display the resulting text on your screen as a complex, functional coded pattern of dots of light and colour. At each stage, integrated, goal-directed intelligent action is deeply involved, deriving from intelligent agents -- engineers and computer programmers. We here consider of course digital signals, but in principle anything can be reduced to such signals, so this does not affect the generality of our thoughts.]
* Now, it is of course entirely possible, that the apparent message is “nothing but” a lucky burst of noise that somehow got through the Internet and reached your machine. That is, it is logically and physically possible [i.e. neither logic nor physics forbids it!] that every apparent message you have ever got across the Internet — including not just web pages but also even emails you have received — is nothing but chance and luck: there is no intelligent source that actually sent such a message as you have received; all is just lucky noise:
* In short, none of us actually lives or can consistently live as though s/he seriously believes that: absent absolute proof to the contrary, we must believe that all is noise. [To see the force of this, consider an example posed by Richard Taylor. You are sitting in a railway carriage and seeing stones you believe to have been randomly arranged, spelling out: "WELCOME TO WALES." Would you believe the apparent message? Why or why not?]
In short, we all intuitively and even routinely accept that: Functionally Specified, Complex Information, FSCI, is a signature of messages originating in intelligent sources . . . .
For in fact, the issue in the communication situation once an apparent message is in hand is: inference to (a) intelligent — as opposed to supernatural — agency [signal] vs. (b) chance-process [noise]. Moreover, at least since Cicero, we have recognised that the presence of functionally specified complexity in such an apparent message helps us make that decision. (Cf. also Meyer’s closely related discussion of the demarcation problem here.)
More broadly the decision faced once we see an apparent message, is first to decide its source across a trichotomy: (1) chance; (2) natural regularity rooted in mechanical necessity (or as Monod put it in his famous 1970 book, echoing Plato, simply: “necessity”); (3) intelligent agency. These are the three commonly observed causal forces/factors in our world of experience and observation. [Cf. abstract of a recent technical, peer-reviewed, scientific discussion here. Also, cf. Plato's remark in his The Laws, Bk X, excerpted below.]
Each of these forces stands at the same basic level as an explanation or cause, and so the proper question is to rule in/out relevant factors at work, not to decide before the fact that one or the other is not admissible as a “real” explanation.
This often confusing issue is best initially approached/understood through a concrete example . . .
This concrete, familiar illustration should suffice to show that the three causal factors approach is not at all arbitrary or dubious — as some are tempted to imagine or assert. [More details . . .]
Then also, in certain highly important communication situations, the next issue after detecting agency as best causal explanation, is whether the detected signal comes from (4) a trusted source, or (5) a malicious interloper, or is a matter of (6) unintentional cross-talk. (Consequently, intelligence agencies have a significant and very practical interest in the underlying scientific questions of inference to agency then identification of the agent — a potential (and arguably, probably actual) major application of the theory of the inference to design.) . . . .
To quantify the above definition of what is perhaps best descriptively termed information-carrying capacity, but has long been simply termed information (in the “Shannon sense” – never mind his disclaimers . . .), let us consider a source that emits symbols from a vocabulary: s1,s2, s3, . . . sn, with probabilities p1, p2, p3, . . . pn. That is, in a “typical” long string of symbols, of size M [say this web page], the average number that are some sj, J, will be such that the ratio J/M –> pj, and in the limit attains equality. We term pj the a priori — before the fact — probability of symbol sj. Then, when a receiver detects sj, the question arises as to whether this was sent. [That is, the mixing in of noise means that received messages are prone to misidentification.] If on average, sj will be detected correctly a fraction, dj of the time, the a posteriori — after the fact — probability of sj is by a similar calculation, dj. So, we now define the information content of symbol sj as, in effect how much it surprises us on average when it shows up in our receiver:
I = log [dj/pj], in bits [if the log is base 2, log2] . . . Eqn 1
This immediately means that the question of receiving information arises AFTER an apparent symbol sj has been detected and decoded. That is, the issue of information inherently implies an inference to having received an intentional signal in the face of the possibility that noise could be present. Second, logs are used in the definition of I, as they give an additive property: for, the amount of information in independent signals, si + sj, using the above definition, is such that:
I total = Ii + Ij . . . Eqn 2
For example, assume that dj for the moment is 1, i.e. we have a noiseless channel so what is transmitted is just what is received. Then, the information in sj is:
I = log [1/pj] = – log pj . . . Eqn 3
This case illustrates the additive property as well, assuming that symbols si and sj are independent. That means that the probability of receiving both messages is the product of the probability of the individual messages (pi *pj); so:
Itot = log1/(pi *pj) = [-log pi] + [-log pj] = Ii + Ij . . . Eqn 4
So if there are two symbols, say 1 and 0, and each has probability 0.5, then for each, I is – log [1/2], on a base of 2, which is 1 bit. (If the symbols were not equiprobable, the less probable binary digit-state would convey more than, and the more probable, less than, one bit of information. Moving over to English text, we can easily see that E is as a rule far more probable than X, and that Q is most often followed by U. So, X conveys more information than E, and U conveys very little, though it is useful as redundancy, which gives us a chance to catch errors and fix them: if we see “wueen” it is most likely to have been “queen.”)
Further to this, we may average the information per symbol in the communication system thusly (giving in termns of -H to make the additive relationships clearer):
- H = p1 log p1 + p2 log p2 + . . . + pn log pn
or, H = – SUM [pi log pi] . . . Eqn 5
H, the average information per symbol transmitted [usually, measured as: bits/symbol], is often termed the Entropy; first, historically, because it resembles one of the expressions for entropy in statistical thermodynamics. As Connor notes: “it is often referred to as the entropy of the source.” [p.81, emphasis added.] Also, while this is a somewhat controversial view in Physics, as is briefly discussed in Appendix 1below, there is in fact an informational interpretation of thermodynamics that shows that informational and thermodynamic entropy can be linked conceptually as well as in mere mathematical form. Though somewhat controversial even in quite recent years, this is becoming more broadly accepted in physics and information theory, as Wikipedia now discusses [as at April 2011] in its article on Informational Entropy (aka Shannon Information, cf also here):
Summarising Harry Robertson’s Statistical Thermophysics (Prentice-Hall International, 1993) — excerpting desperately and adding emphases and explanatory comments, we can see, perhaps, that this should not be so surprising after all. (In effect, since we do not possess detailed knowledge of the states of the vary large number of microscopic particles of thermal systems [typically ~ 10^20 to 10^26; a mole of substance containing ~ 6.023*10^23 particles; i.e. the Avogadro Number], we can only view them in terms of those gross averages we term thermodynamic variables [pressure, temperature, etc], and so we cannot take advantage of knowledge of such individual particle states that would give us a richer harvest of work, etc.) . . . >>
______________
I trust this background context will allow us to have a fairly balanced context in which to assess the matter of inferring signal thus intelligence in purposeful action rather than noise that got lucky, because of the adaptation of signals to the communication conventions and system structures and protocols being used. Where of course the mere existence of the metrics signal to noise ratio, noise figure/factor and noise temperature already implies that in many relevant cases one may readily distinguish the characteristics of the two and measure the relevant power spectra etc to extract such values.
Further to this, in systems and contexts of relevance to design theory, we have functionally specific complex organisation and associated information, FSCO/I, with a complexity metric based on length of the chain of structured y/n q’s to describe the relevant wiring diagram pattern (which may be a s-t-r-i-n-g) will exceed 500 – 1,000 bits. That is, there is a threshold that sets a needle in haystack search challenge such that blind chance and necessity on the scale of ~10^17 s and 10^57 atoms as searchers/observers [sol system] or 10^80 atoms as same [observed cosmos] will be hopelessly overwhelmed by the scope of the config space of possibilities for all practical purposes. For 1,000 bits, the search scope at 10^13 – 14 searches per atom per s . . . a fast chem rxn rate . . . would be 10^110 – 111, relative to a space of 1.07*10^301 possibilities. A back of envelope exercise will show that the ratio that takes the scope of search as one straw size would confront a haystack that dwarfs the observed universe.
In such a context, we may confidently and reliably infer that if something portrayed as such a blind needle in haystack search has come up trumps, picking up deeply isolated needles (islands of function) then it is because it was not genuinely blind.
Indeed, one can put forward a concept of the injected information required to bridge between what blind search would do and what is observed. Especially, as the search for a golden search that beats those odds somehow will come from a much higher order set than the original space of possibilities. For, a search of a space is a subset of it, so the set of possible searches is the set of subsets. Where there are W configs, the cardinality of the power set is 2^W, i.e. exponentially larger.
This is the context for the Marks-Dembski contention that search for search gets so much harder successively that one reverts to the original search and the conclusion is that on average one has no good reason to expect that a blindly chosen blind search will outperform a straight flat random search; given that one is crossing vast seas of non-function blindly in hopes of hitting on shorelines of function that will then allow non-random hill climbing on self-reinforcing increments in fitness.
The challenge is to get to islands of function, not to hill climb within such an island, for OOL and for OO body plans (OOBP).
The gap between the expected no hope result and the achievement of FSCO/I can then be reasonably taken as a metric of injected intelligent, active information that has reduced the scope of search to manageable proportions.
And from this we see the significance of FSCO/I and of active information.
KF
What types of phenomenon are “Unknown causes” capable of producing? Unknown causes is a god of the gaps solution. It can explain anything. We know what intelligence can do: produce information, produce cybernetic systems, produce irreducibly complex systems, use mathematical formulas and numerical values (ie fine tuning) etc. When we find these in nature and can’t explain them by chance and/or necessity, intelligence is the best explanation. “Or it might be due to something unknown” is implicit in every scientific statement not just in ID. See Karl popper: you can’t prove a scientific theory you can only falsify it. But for some reason ID proponents (and everyone else who proposes something controversial – the “unknown cause” comes up in parapsychology too) are supposed to prove the theory.
AS, in OP:
I am sorry, to misrepresent design as a “default” in the OP is a loaded strawman caricature of the design inference process.
Let us go to a dictionary, here CED:
In other words, something that is only resorted to on eliminating TWO first resorts, in a context of a justifiably finite and restricted list of possibilities is the OPPOSITE of a default.
Where, from Plato in the Laws Bk X 2350 years ago on, it has been well known that phenomena routinely come as produced by one or more of chance, mechanical necessity or intelligently directed configuration. That is a strongly established fact.
Mechanical necessity produces low contingency regularity under sufficiently close initial circumstances. That is its signature and the launchpad for seeking explanation per mechanical laws such as F = m*a or F = G m1m2/r^2 etc. This is foundational to the rise of modern science.
Next, and particularly in light of the study of matter at molecular scale, in the past two centuries, it was recognised that statistical behaviour reflective of chance was also to be reckoned with, so chance was admitted and is readily recognised from stochastic patterns. In comms contexts we know the familiar flickering grass on the CRO screen, and things like white noisem flicker/pink noise, shot noise, Johnson noise in resistors etc are well studied phenomena. More broadly, chance can be seen as resulting from clash of uncorrelated causal chains leading to unpredictable outcomes beyond some distribution or other (flip 1,000 coins, and see the binomial distribution emerge . . or, ponder a 1,000 atom paramagnetic substance in a weak B field that would give parallel/antiparallel alignments). Or else, many quantum phenomena seem to be directly stochastic.
The third factor is the kind of intelligently directed configuration you used to create the OP.
The three are distinct, no one has reasonably been able to say collapse design into chance and necessity per an observationally justified adequate causal process, i.e. something that meets the vera causa test of Newton acknowledged by Lyell and Darwin.
The design inference explanatory filter (especially in per aspect form) then exerts two successive defaults. First, mechanical necessity.
This breaks where high contingency on initial conditions is observed for a given aspect of an object, phenomenon, process etc.
For example, a die is a heavy object and routinely falls at 9.8 N/kg on being dropped under typical circumstances. On hitting the table etc, a butterfly effect process ensues due to eight corners and twelve edges. This shows a low contingency aspect and a high contingency one. The latter leads to tumbling and settling to a value in a flat random distribution, for a fair die.
So the second default is blind chance leading to some reasonable distribution of possible outcomes.
But when outcomes are highly contingent and fall well outside the reasonable expectations of chance and/or necessity due to FSCO/I, then we have an empirically and analytically well warranted adequate cause. Intelligently directed configuration, design.
So, the design inference process is reasonable and not at all like the strawman “default” you presented in the OP.
That you make such an error at almost the outset of your considerations drastically undermines your further case.
I suggest you correct it.
KF
PS: You then proceed to the clip from a remark that Dembski subsequently explained and emphasised its compatibility with the explanatory filter approach, as is discussed in the weak argument correctives under the resources tab, top of this and every UD page. I cite no 30:
Resort to such weak talking points progressively undermines the credibility of the objection argument being made.
Jim Smith,
I think that harping on the number of hits for “evolutionary search” is not such a great idea. It, and also “evolutionary optimization,” originated with technologists. I suspect that the back-application to biology reflected formalism-envy among biologists, which I know was a problem for some. In any case, the terminology does not indicate that evolutionary biologists are unaware teleologists, in need of philosophers to make them mindful.
The “search” in terms of which active information is defined does not search. Quite simply, it does not have an input to indicate what to search for. It depends in no way on the target. That’s the essence of why Dembski, Ewert, and Marks can represent a “search” as a probability distribution.
What constitutes a search is a potentially informed entity selecting and initiating a “search” (uninformed selection process) in order to cause the target event to occur. What Dembski and Marks have called the “search-forming process” is the entity that possibly searches. The process it forms, as modeled by Dembski, Ewert, and Marks, does not, in and of itself, search.
It’s been a while since I read Investigations, but I don’t recall that Kauffman, as an emergentist, suggested the existence of something that exploited information of a target event to form a process to generate it. What I’m sure of is that he has objected strenuously, in recent years, to the notion that we can assign probabilities to evolutionary trajectories. That amounts to complete rejection of the representation of an evolutionary process as a probability distribution.
AS, I really need to be getting on with the day, but in the next step you cite Felsenstein making yet another strawmamn argument. The issue is not hill climbing within a nicely behaved island of function with a smooth fitness function (itself a major challenge per Axe et al) but to FIND such islands in vast config spaces under the challenge fuirst of OOL then OOBP, with 100 – 1,000 kbits and 10 – 100+ mn bits of just genome info on the table. The FSCO/I needle in haystack challenge to find functional wiring diagram coonfigs in possibility spaces kicks in at 500 – 1,000 bits. Where for every bit beyond the threshold the space DOUBLES. Again, this deeply undermines the credibility of your argument as it is a tilting at a strawmam again. In a context where, for years, the real argument has been oput and explained and the strawman corrected. I finally note, OOL is the root of the tree of life and no roots, no trunk or branches (where OOBP is about main branches that lead onwards to the full range of life forms). And surely, the challenge to find such configs in a vast field of physically possible alternatives MUST be relevant to both OOL and OOBP, thus to all of biological study of origins; the irrelevant mathematics objection fails. KF
I think there are deeper conceptual problems with active information and indeed the whole LCI.
We somehow get from defining the difference between
p = prob(success|blind search)
and
q – prob(success|alternative search)
to prob(alternative search) = p/q
But if you look carefully at the literature this inversion of probabilities is never really justified. It requires:
1) Treating possible searches as a random variable
2) Selecting an arbitrary way of enumerating possible searches (a “search” is defined as an ordered subset of all the variables to be inspected)
3) Arbitrarily using Bernouilli’s principle of indifference to decide all searches are equally probable within this space of all possible searches
Each step is highly dubious.
Onlookers, please mark the focus on substance here. KF
MF, One last point for now: with all due respect, nope. The possibility of many different clumped and/or scattered arrangements is an obvious reality. To find FSCO/I rich configs in the space of possibilities starting in Darwin’s warm pond or a volcano vent or a comet core etc, beyond mere formation of monomers (itself a challenge) is thus relevant and at the root of the TOL. With design ruled out for argument that leaves blind chance and/or mechanical necessity as hoped for causal explanations, in the face of a beyond astronomical scope blind search. You may hope to find a golden search of so far unmet promissory note character that upends the sort of consideration that leads to the conclusion that straight search with a typical random search as yardstick points to overwhelming improbability, but then you have the challenge that was outlined above. Namely, searches are subsets so blind searches for golden searches are blindly searching not in config space of W possibilities, starting for relevance at W = 10^150 – 301, but in spaces of scale 2^W, exponentially more difficult. This has been pointed out in your presence several times, but you have consistently failed to address it. Such, being consistent with your repeatedly announced policy to ignore remarks I make and./or to find excuses to project incoherence and/or incomprehensibility — I add this for the new onlooker who will not know the years of exchanges that lie behind what is on the table today. KF
Kairosfocus,
I’m having trouble understanding your remarks, because I don’t know how FSCO/I is related to active information. Would you explain that to me, please? As Mark Frank has indicated, the active information is
log(q/p) = log q – log p,
where p is the probability that a “totally random” guess generates the target event, and q is the probability that the “search” (selection process) generates the target event. (However, Mark contends that “totally random” is not well defined.) The more formally you can express the relation of this measure to FSCO/I, the better for me.
SL, I passed back for a moment. In effect functionally specific complex organisation and/or associated information (FSCO/I) denotes complex functionally organised configs of parts per a wiring diagram pattern that produces a result based on interaction. Text strings bearing coded info and fishing reels etc are typical examples. There are many cases in cell based life from the cell on up. Following Orgel and Kolmogorov et al (as well as AutoCAD etc), we may see that such can be reduced informationally to a structured string of Y/N q’s, that formally describe the config that works. Think, circuit diagram, exploded view, coded string etc. The key is to recognise that such requisites of organised function tightly constrain the configs that maintain function to narrow zones T in much bigger spaces of clumped or scattered configs for the parts, W. Thus, needles in haystacks or islands of function in seas of non function. The 500 – 1,000 bit threshold sets a scope that is not amenable to blind search as already outlined. Under these conditions, blind searches on avg will reliably not outperform a flat random blind search as a yardstick. And, search for a golden search that magically plunks us down next to or within an island of function, is exponentially harder than the straight needle in haystack blind search. The odds of finding zones T in W on blind search define p, and the injected active info bridges the gap. Info, of course, is measured as outlined further above, on negative log probability, hence we can go back and forth between the two in our analysis, noting the reason why Marks & Dembski used simple random search as warranted yardstick. Invariably, on analysis, such active information is intelligently inserted, often unrecognised. I find, the best simple approach is to think in terms of config spaces as haystacks and islands of function as needles in them. Then we can see the scope of search to scope of space issue and resulting utter implausibility of blindly finding a needle. If a needle is actually found, that is strong reason to believe the search was in fact intelligently guided. Then, go back and re-read the Marks-Dembski papers with that background in mind, which may be a bit hard to spot directly from the papers. KF
Really? Let’s look at one of the other definitions KF quoted, and which he completely ignored:
As KF has agreed, Dembski’s filter resorts to ‘design’ only in the absence of the alternatives of chance and necessity. It is thus the default by one of the definitions he posted.
It would be unfair to ascribe the above farce to deliberate deception, unless KF is dumb enough to forget to delete the other definitions. The retention of that context also means it isn’t quote-mining. I’ll leave the reader to determine the default option.
In the meantime, I look forward to seeing KF explaining that the designer isn’t God since God doesn’t work in the fashion industry, and that genes aren’t information since they don’t line up equidistantly in straight lines.
Roy
A point worth making, I think, is that it can be misleading to separate the concept of the “fitness landscape” from the search algorithm you are considering.
An “evolutionary algorithm” in practical terms, is not simply a discrete search strategy that can be applied to any “fitness landscape” where this is separately defined. The concept of an evolutionary algorithm inherently implies the existence of a population of self-replicators that replicate with variance. A population in which the offspring of any one individual, or pair of individuals, bore no relation to its parents could not be considered a population of self-replicators. In other words, it is part of the basic description of an “evolutionary algorithm” that offspring have similar properties to their parents – in other words that they are situated “near” their parents on the fitness landscape.
In other words, although, mathematically, it may make sense to consider the performance of various “search” algorithms over “all possible fitness landscapes”, in terms of a model of reality, it makes no sense, because any “search” algorithm worthy of the name of “evolutionary search” comes with its own moderately smooth fitness landscape built in.
And will therefore always do better than “blind search” over a comparable fitness landscape.
I have another couple of points to make, but I’ll see if this one posts first!
Kairosfocus,
You’ve given me an idea of FSCO/I, but I still don’t know the definition. Presumably the complexity is –log q, where q is the probability that a strictly naturalistic process generates the target event, just as for Dembski. You differ in description of the event, do you not? Once we agree on the event and the description language, the descriptive complexity of the event is a constant D. I don’t care about the details of calculation. For Dembski, the specified complexity is
SC = –log q — D.
Things might go better if I change my request: Would you please relate FSCO/I formally to SC? More narrowly, can FSCO/I be expressed as a difference of (probabilistic) complexity and descriptive complexity?
OK, we seem to have communication!
A second point I think worth making regarding the issue of probability as information is that the probabilities in question are frequentist probabilities. In other words, they are only calculable if you know (or can estimate, from data) the frequency distribution of the patterns, or whatever, in question. However, once we grant (as I think we should) that evolutionary search is better than blind search on any fitness landscape in which the process can be properly said to be “evolutionary” (i.e. as in my previous post, one in which offspring have similar properties to their parents), then the question becomes not: “how probable is it that an evolutionary process will find good complex solutions to surviving in a given environment?” (answer: high) but “how probable is it that an evolutionary process will arise?”
And that is simply not possible to calculate – we simply do not have the data from which to estimate the frequency distribution in question. It may be that our universe, or a universe in which evolutionary processes can arise, are rare in the population of all possible universes, or it may be that they are very common. But we do not know which!
To put that in the language of DEM, we do not know whether the amount of “Active Information” in our universe is a uniquely adequate amount to “fund” the phenomenon of evolutionary process, or not.
For instance “1/f” seems to be a recurring feature of the patterns in our universe, and I suggest that this “1/f” property is precisely the property that a universe that lends itself to life will tend to have. Does it take a Mind to construct a 1/f universe? Or is 1/f simply a highly probable consequence of existence itself?
The reason that 1/f-ness is important of course, is that any fitness landscape with 1/f properties will tend to be smooth at multiple scales – which is what a fitness landscape needs to be if evolutionary processes are to get ver far.
SL, I am on a key Skype call to B’dos, but will clip my IOSE. FSCO/I is descriptive, and quantifiable:
_______________
http://iose-gen.blogspot.com/2.....l#fsci_sig
>> D: The significance of complex, functionally specific information/ organisation
The observation-based principle that complex, functionally specific information/ organisation is arguably a reliable marker of intelligence and the related point that we can therefore use this concept to scientifically study intelligent causes will play a crucial role in that survey. For, routinely, we observe that such functionally specific complex information and related organisation come– directly [[drawing a complex circuit diagram by hand] or indirectly [[a computer generated speech (or, perhaps: talking in one's sleep)] — from intelligence.
In a classic 1979 comment, well known origin of life theorist J S Wicken wrote:
The idea-roots of the term “functionally specific complex information” [FSCI] are plain: “Organization, then, is functional[[ly specific] complexity and carries information.”
Similarly, as early as 1973, Leslie Orgel, reflecting on Origin of Life, noted:
Thus, the concept of complex specified information — especially in the form functionally specific complex organisation and associated information [FSCO/I] — is NOT a creation of design thinkers like William Dembski. Instead, it comes from the natural progress and conceptual challenges faced by origin of life researchers, by the end of the 1970′s.
Indeed, by 1982, the famous, Nobel-equivalent prize winning Astrophysicist (and life-long agnostic) Sir Fred Hoyle, went on quite plain public record in an Omni Lecture:
So, we first see that by the turn of the 1980′s, scientists concerned with origin of life and related cosmology recognised that the information-rich organisation of life forms was distinct from simple order and required accurate description and appropriate explanation. To meet those challenges, they identified something special about living forms, CSI and/or FSCO/I. As they did so, they noted that the associated “wiring diagram” based functionality is information-rich, and traces to what Hoyle already was willing to call “intelligent design,” and Wicken termed “design or selection.” By this last, of course, Wicken plainly hoped to include natural selection.
But the key challenge soon surfaces: what happens if the space to be searched and selected from is so large that islands of functional organisation are hopelessly isolated relative to blind search resources?
For, under such “infinite monkey” circumstances , searches based on random walks from arbitrary initial configurations will be maximally unlikely to find such isolated islands of function. As the crowd-source Wikipedia summarises (in testimony against its ideological interest compelled by the known facts):
So, once we are dealing with something that is functionally specific and sufficiently complex, trial-and error, blind selection on a random walk is increasingly implausible as an explanation, compared to the routinely observed source of such complex, functional organisation: design. Indeed, beyond a certain point, the odds of trial and error on a random walk succeeding fall to a “practical” zero. >>
_______________
I trust this will help to give background.
KF
Elizabeth Liddle,
The fitness function, if any, is part of the “search” itself. Almost everybody stumbles on that point.
(Yes, folks, evilutionists do correct one another in public.)
F/N: I repeat, the pivotal issue to be explained is not hoped for hill climbing within islands of function but to get to islands of function by blind search on the gamut of sol system or observed cosmos. When you observe consistent brushing this aside to talk about things within such islands, questions are being insistently begged. KF
Earth to Elizabeth Liddle- Genetic and evolutionary algorithms model intelligent design evolution and have nothing to do with natural selection.
Also if your position had something- a model, testable entailments, actual evidence, then we could check it out. However it doesn’t so all we can do is discuss probabilities even though you can’t even show a feasibility.
That yours is even included in a probability discussion is giving it more than it deserves. And the funny part is you aren’t even aware of any of that.
Simont_eberge- Correct the evolutionists by telling them genetic and evolutionary algorithms have goals and natural selection does not. Those algorithms are actively searching for a solution whereas natural selection isn’t even a search.
#20 SimonL
It is also true that the fitness function is the “target” (to the extent that target makes sense in this context). All evolution does is evolve organisms to a state where they are sufficiently fit to survive. I think this is a key misunderstanding because artificial simulations are sometimes accused of sneaking in the information about the target via the fitness function. But actually by creating a fitness function they are creating a target.
F/N 2: WmAD in NFL — yes on public easily accessible record for over a decade — on CSI in the context of biofunction (thus enfolding FSCO/I]:
______________
http://iose-gen.blogspot.com/2.....ml#wd_defn
>> p. 148:“The great myth of contemporary evolutionary biology is that the information needed to explain complex biological structures can be purchased without intelligence. My aim throughout this book is to dispel that myth . . . . Eigen and his colleagues must have something else in mind besides information simpliciter when they describe the origin of information as the central problem of biology.
I submit that what they have in mind is specified complexity [[cf. here below], or what equivalently we have been calling in this Chapter Complex Specified information or CSI . . . .
Biological specification always refers to function. An organism is a functional system comprising many functional subsystems. . . . In virtue of their function [[a living organism's subsystems] embody patterns that are objectively given and can be identified independently of the systems that embody them. Hence these systems are specified in the sense required by the complexity-specificity criterion . . . the specification can be cashed out in any number of ways [[through observing the requisites of functional organisation within the cell, or in organs and tissues or at the level of the organism as a whole. Dembski cites:
Wouters, p. 148: "globally in terms of the viability of whole organisms,"
Behe, p. 148: "minimal function of biochemical systems,"
Dawkins, pp. 148 - 9: "Complicated things have some quality, specifiable in advance, that is highly unlikely to have been acquired by ran-| dom chance alone. In the case of living things, the quality that is specified in advance is . . . the ability to propagate genes in reproduction."
On p. 149, he roughly cites Orgel's famous remark from 1973, which exactly cited reads:
In brief, living organisms are distinguished by their specified complexity. Crystals are usually taken as the prototypes of simple well-specified structures, because they consist of a very large number of identical molecules packed together in a uniform way. Lumps of granite or random mixtures of polymers are examples of structures that are complex but not specified. The crystals fail to qualify as living because they lack complexity; the mixtures of polymers fail to qualify because they lack specificity . . .
And, p. 149, he highlights Paul Davis in The Fifth Miracle: "Living organisms are mysterious not for their complexity per se, but for their tightly specified complexity."] . . .”
p. 144: [[Specified complexity can be more formally defined:] “. . . since a universal probability bound of 1 [[chance] in 10^150 corresponds to a universal complexity bound of 500 bits of information, [[the cluster] (T, E) constitutes CSI because T [[ effectively the target hot zone in the field of possibilities] subsumes E [[ effectively the observed event from that field], T is detachable from E, and and T measures at least 500 bits of information . . . ” >>
________________
Notice the config space context and the implication of deep needle in haystack blind search challenge to find islands of function.
KF
PS: My last discussion on FSCO/I here at UD was here:
http://www.uncommondescent.com.....-relevant/
Mark Frank:
Obviously they are already there, Mark. Evolutionism starts with such organisms.
Also a fitness function isn’t a target. It is something that checks to see how close the current product is to the solution.
F/N: Note the onward begged question of finding islands of function, especially at OOL but also at OOBPs. KF
kairosfocus: Note the onward begged question of finding islands of function, especially at OOL
Basic replicators are presumed in the discussion of so-called active information.
Basic replicators will always be basic replicators. Also replication is the very thing that requires an explanation.
Simon, yes, I understand that (I think). My point is that the only kind of “evolutionary” process that would be no better than random search would not be like any “evolutionary process” that actually exists. We’d have to postulate offspring were similar to their parents in no respect that affected their capacity to breed. So that would mean that either they were really really unlike their parents (in which case we wouldn’t call them “self-replicators”) or that their similarities were completely orthogonal to their capacity to breed.
Which may be of mathematical interest, but seems irrelevant, unless someone is postulating that a designer is needed to ensure that two breeders with similar properties should often include properties that affect their ability to breed.
Natural selection has not been refuted but it has been proven to be impotent wrt universal common descent.
For the purposes of the no free lunch theorem a search is an algorithm that traverses a landscape and has some criterion to identify “success”. Mutation and natural selection is an algorithm that traverses the fitness landscape, even as the landscape is changing, and “survival” is the measure of success.
If you had a supercomputer and a super-algorithm you could simulate mutation and natural selection on a computer and determine if it can achieve survival better than a random algorithm. The no free lunch theorem applies to mutation and natural selection as it does to any algorithm.
Jim Smith: If you had a supercomputer and a super-algorithm you could simulate mutation and natural selection on a computer and determine if it can achieve survival better than a random algorithm.
You hardly need a supercomputer. An evolutionary algorithm works poorly on chaotic landscapes, but well on many non-chaotic landscapes.
Evolutionary algorithms do not simulate natural selection, Zachriel. You are confused.
Z, evolutionary algorithms both presume being on an island of function and are fine tuned to work by their designers. Yes, designers, they are an example of intelligently directed configuration yielding functionally specific complex organisation. No credible, empirically warranted observationally demonstrated case of such an algor or similar case of FSCO/I arising by blind chance and necessity has been shown. KF
PS: The proper start point is a pond or volcano vent or comet core or gas giant moon etc with reasonable chemicals. No reasonable blind chance and mechanical necessity driven path has been observationally, empirically warranted from such to a gated, encapsulated, metabolic automaton with a code using self replication facility. Likewise, embryologically feasible body plans reasonably require 10 – 100+ mn, not 100 – 1,000 k bases of genomic material. No observationally warranted blind watchmaker mechanism has been shown capable of these feats or significant steps to them. Speculation rooted in materialist a priorism has been imposed instead. As for instance Lewontin so candidly acknowledged.
Well, no, Joe. Evolutionary algorithms do precisely that – they not only simulate natural selection (via the fitness criteria) but random mutation as well. And they can also be used in their own right as design tools – to solve problems that human designers can’t solve otherwise.
KF: clearly a self-replicator cannot “evolve” from a non-self-replicator, so to that extent, by definition, a the simplest self-replicator is on an “island” that cannot be reached via evolution. However, what we do not know is just how simple that self-replicator had to be in order to kick-start the process.
But that, in any case, is not the topic of Ewert, Dembski and Marks papers, which appear to me to be making the argument that EVEN IF we assume a that a self-replicating population exists, the solutions “found” by such a population are making use of “Active Information” that has to be provided from somewhere.
So it would probably be useful to focus on that specific argument.
And I think the simple answer is that that “Active Information” is simply that in the literal landscape itself – the environment that the population inhabits. The “information” that causes one critter to produce more offspring than another critter’s offspring consists of the threats and resources off that environment.
And the richer the variety of that environment, in terms of potential threats and resources, then the more information it contains, quantifiable in bits, if you like.
kairosfocus: Z, evolutionary algorithms both presume being on an island of function
Evolutionary algorithms explore the behavior of replicators, so start with whatever it takes to replicate successfully.
kairosfocus: clearly a self-replicator cannot “evolve” from a non-self-replicator
That’s not clear, but is irrelevant in any case.
kairosfocus: So it would probably be useful to focus on that specific argument.
That is the topic of the thread.
kairosfocus: And the richer the variety of that environment, in terms of potential threats and resources, then the more information it contains, quantifiable in bits, if you like.
Yes. Replicators incorporate information about its relationship to the environment.
Kairosfocus,
There is absolutely no rush. This is a thread on active information. You brought up FSCO/I repeatedly. My response is: “OK, I wasn’t going to push the question of how active information and specified complexity ‘live together’ in ID theory. But if you insist that a kind of specified complexity is relevant, then I insist that you make rigorous comparison to active information possible.”
If you want FSCO/I to be on the table with active information, then you’ve got to define it formally. No amount of background is a substitute for something like
AI = log q — log p,
where q is the probability that a model of evolution generates an event of interest, and p is the probability that a baseline model generates that event. I can relate active information to specified complexity because Dembski, and now Ewert, Dembski, and Marks, have ventured formal definitions.
If you don’t have a formal definition, then I’d ask that you give folks a chance to discuss a measure that is formally defined, is in peer-reviewed papers, and is rarely mentioned at UD. In Being as Communion, Bill Dembski relegates specified complexity to a footnote, and devotes the final three chapters to active information. DEM came through with a conservation-of-information theorem for active information, not specified complexity.
Roy, that’s a strawman based on a distortion of both the circumstances and what alternatives means. There are TWO, not one, successive alternatives considered, and they would be broken based on reasonable criteria backed up by empirical warrant. Unless you can show a reasonable fourth option or reduce three to two per empirical observation backed argument, we face a three way split and good reason to infer to design as best cause of FSCO/I, as it is highly contingent [so not deterministic mechanism] and it is both complex beyond a threshold and functionally specific per interactive organisation [so on an island of function maximally implausible to be found by blind search]. Where also, it is the case that on trillions of cases FSCO/I is reliably the adequate cause of said FSCO/I. You simply cannot show a single case of blind chance and/or necessity credibly causing FSCO/I, or you would be trumpeting it instead of playing at twisty definition games. KF
Jim Smith:
For the purposes of the no free lunch theorem a search is an algorithm that traverses a landscape and has some criterion to identify “success”.
The NFL theorems do not apply to “search” as defined by DEM. I recently heard Dembski say that his theorems are “in the spirit of the no free lunch theorems,” or some such.
To put it simply, in the NFL framework, the fitness function is part of the problem. In the framework of DEM, the fitness function, if any, is part of the solution.
Jon Garvey wrote:
I think the problem here is that wretched word “random”. It has too many meanings to be useful! Sometimes it means “unintended”; sometimes it means “equiprobable”; sometimes it means “unpredictable”; sometimes it means “orthogonal”; sometimes it means “stochastic”. And, of course, Darwin didn’t use the word at all! So I think it’s really important to be clear which we mean when we discuss evolutionary processes.
Our current understanding of evolutionary processes is that both variation and “selection” are stochastic events – in other words, they are predictable statistically, in bulk (just as one can predict, statistically, that around 50% of coin tosses will be heads) but not predictable, necessarily (or at least not without a great deal of not-normally-available information) individually. So while we can predict that certain genes will show certain kinds of mutation more often than others, and that every new organism will have a certain number of mutations, we can’t predict who will get what, even though we can predict that most offspring will be quite similar to their parents and their siblings. Similarly, we can’t predict very well which of them will fall under a bus before reproducing, nor, on the other hand, go on to produce record numbers of offspring, we can say, more or less, that a certain proportion people will die without issue under a bus in any given year, and we can even say that those who don’t are slightly less likely to be blind, deaf or suicidal than those who do.
So the idea that there are “random” variations being acted on by “non-random” environmental events is not really a defensible one. What is important, however, is that in general, the first is “non-random” with respect to the second. It is probable (but not certain) that any given mutation is no more likely to appear de novo when it is not – and in evolutionary algorithms this is normally the case. In fact, it’s why they are so useful – no “second guessing” of what is likely to turn out to be useful is employed, and so the system is free to explore “lines of enquiry” that a more far-sighted “designer” would reject as unfruitful.
And just as variant offspring are similar to their parents, so novel environments tend to be similar to the preceding one. If it is warmish here, this year, it is likely to be still warmish, a few miles away, next year.
So neither mutations nor environmental changes are “random” in the “equiprobable” sense, which is why “white noise” fitness landscapes are irrelevant to the discussion!
Practically speaking, that means that Critter A, fairly well suited to Environment B is likely to have offspring similarly suited to both Environment B and Environment B+a few miles. That is the “active information” that makes the “search” of the population of which Critter A is a member of an optimal solution to the problem of surviving and breeding in Environment B and its near-neighbours a search of a smooth fitness landscape. And in a smooth fitness landscape, evolutionary processes work really well (as Ewert, Dembski and Marks agree).
The question is therefore: do we need to invoke a designer to account for the “active information” inherent in a) the similarity of offspring to their parents or b) the similarity of one environment with the nearest neighbour in space or time?
Regarding a): if it were not the case, we wouldn’t call the critters self-replicators anyway! So the question would be moot. Regarding b) is there something “unnatural” about a universe in which places near in space and time tend to be similar to each other? If that is Ewert, Dembski and Marks’ argument, then I think it needs to be be made more explicit!
Elizabeth Liddle:
Nonsense. Natural selection is not a search and does not have a goal. Evolutionary algorithms are both a search and goal-oriented.
It is obvious that you have no idea what natural selection is nor what it entails.
Jon Garvey: But a “kaleidoscope of constant change” is at least as random as mutations are supposed to be.
The environment is not random, with changes primarily cyclical.
-
Edited for clarity
The word “random” wrt biology and evolution means happenstance- as in accidental, errors and mistakes- not planned.
Zachriel:
Which is why natural selection brings about a wobbling stability, which excludes universal common descent.
Zachriel, for some reason you have attributed some of my comments to Kairosfocus! So let me address your responses:
It seems clear to me
As self-replication is a prerequisite for evolution, the first
self-replicators must have had a non-self-replicating precursors, which
cannot, therefore, have produced them by self-replication with variation
in reproductive success!
In other words, we cannot invoke evolutionary process as a cause of self-replication itself. To that extent I agree with kairosfocus, but I don’t think anyone is arguing otherwise.
Indeed.
Yes. And we could quantify that information in conventional terms. I mentioned “1/f ness” earlier – and it seems to me that is quite important: the natural environment offers a great deal of variety at many different scales – it has multi-scale entropy (easily expressed in bits), which means it not only has both smoothness and variety whether we are talking about viruses or blue whales, but also smoothness between scales.
And that self-similarity property of the environment seems to be a result of fairly fundamental physical laws, hence the utility of Reynold’s numbers.
Elizabeth Liddle: for some reason you have attributed some of my comments to Kairosfocus! So let me address your responses
Er, just ignore the comment.
Joe:
Exactly. Which is why Ewert, Dembski and Marks are looking in the wrong place! They are likening evolution to a search, which it isn’t, with a “target” which it doesn’t havce, as you say.
The only sense in which evolution is a search is the sense in which it tends to optimise populations of self-replicators for self-replication, in any given environment. And the only sense in which it has a “goal” or “target” is in the sense of that optimal state.
They use the exact same process as evolution to solve (often) a human-defined problem. To do this, the human being designs an environment that represents the problem she wants solved. She does not design the solution, which would be pointless.
The whole set-up results in the evolution of a population of self-replicators that, in optimising their own reproductive success in that environment, also solve the human’s problems. But the mechanism is the same as in nature. The only difference lies in the design of the environment.
Joe:
It’ll wobble round a stable point if the environment wobbles round a stable point. If the environment makes a steady move in a particular direction (as may happen with climate change for instance) then populations will either go extinct or adapt along that same trajectory. Which they do will largely depend on how fast the change is.
Elizabeth Liddle:
Which is why evolution is useless and doesn’t do anything beyond changing allele frequencies.
That is false and demonstrates ignorance of evolution. How can it be the same process when it is obviously a very different process?
Elizabeth:
With climate change there is still plenty of ups and downs.
Sure. But the net direction is non-stationary, so instead of wobbling round a mean, the mean itself is moving. If it weren’t, we wouldn’t call it “climate change”.
The climate has been changing since the planet’s inception. And yours still doesn’t have a mechanism capable of explaining life’s diversity.
Elizabeth Liddle: As self-replication is a prerequisite for evolution, the first self-replicators must have had a non-self-replicating precursors, which cannot, therefore, have produced them by self-replication with variation in reproductive success!
There may be an in-between state, where replication is incomplete, but pushed along by metabolic processes, while providing some sort of selective advantage. Without a valid theory, it’s hard to say one way or the other.
Joe:
Well, in the context of biological populations of sexually reproducing organisms, the process also include the generation of new alleles. More generally, it includes the process of variance generation. And the frequencies of those variants will indeed change as a result of changing environmental pressures (as well as drift).
Which means it is far from useless! As long as the rate of variance-generation is fast enough to keep pace with the rate of environmental change, there is nothing to stop a population adapting to long-term environmental change, as opposed to being stuck “wobbling” round a fixed point.
It isn’t a very different process. It has exactly the same core features: a population of self-replicators that reproduce with heritable variance in reproductive success in the current environment.
The only difference is that in human-designed systems that are designed to solve a specific problem, the environment is designed in such a way that it expresses the problem the human wants solved. For instance, it could be set up to evolve an optimal antenna – because the human wants a good antenna.
The same process happens in nature, only nobody needs the antenna apart from the evolving critters themselves! And they might evolve ears instead, if that did the job better, or as well, within the environment they found themselves in. A human would have to make sure that eyes and ears weren’t advantageous if they specifically wanted an antenna.
Oh dear!
My first chance to comment and I see the thread is already being derailed.
I will try and respond to comments over the weekend. Thanks again to johnnyb for hosting the post and may I echo KF in comment 11 in appreciating the largely equable tone so far.
Zachriel: yes, that is a good point, but kinda small-print stuff in this context! As you said, “irrelevant”. In general, I take Kairofocus’s point that if we are going to discuss evolution (as opposed to OoL) we are effectively (as Ewert, Dembski and Marks do) assuming that the self-replicators exist.
A discussion on how to get from non-self-replicators to proto/semi/partial/occasional/inaccurate self-replicators is a different discussion! But yes, I do take your point. My hunch is that we will have OoL licked within my lifetime! Or at least demonstrated that you can, under lab conditions, go from some kind soup of polymers and lipids to some kind of protocell population with quasi-self-replicating properties and capable of evolution. Or maybe we are there already – I’ve been out of the loop!
Cyclical means wobbling around a fixed mean. There have been warmer periods and cooler periods. If populations adapt to that pattern then the adaptations would wobble around a mean. Beaks would sometimes grow longer and other times shorter. And that’s what we see.
It illustrates Joe’s point @ 53. That’s not a mechanism that explains life’s diversity.
Silver Asiatic: Cyclical means wobbling around a fixed mean.
In terms of the environment, there are regular cycles, such as the diurnal cycle, and chaotic cycles, such as climate, not to mention contingent events.
Silver Asiatic: Beaks would sometimes grow longer and other times shorter. And that’s what we see.
Yes, that’s exactly what is expected of natural selection. In the case of Darwin’s finches, it led to sufficient changes to result in over a dozen species, some that forage on the ground, others in trees, some feeding on cactus, others on insects, and one subspecies, the Vampire finch, even feeding on blood.
So: back on topic!
Aurelio, I entirely agree that the “Active Information” that Ewert, Dembski and Marks’ identify as being intrinsic to the successful “search” for a “solution” in evolutionary systems is indeed intrinsic to the environment.
Do you agree that if they want to make the argument that this implies a Designer, they need to make the argument that it is somehow improbable that an environment would have the properties required to generate a solution to the problem of breeding in it?
Elizabeth:
You just described baraminology.
It is useless wrt universal common descent.
One is an active search seeking a pre-defined goal. The other isn’t a search and doesn’t have any goals. Very different processes.
So seeing that all animals have the same core features they are all the same?
That is a huge difference. HUGE. That makes all of the difference in the world. Natural selection could never even produce the different breeds of dogs. Whatever works stays. And whatever works can be any number of different things- taller, shorter, faster, slower, stinky, fat, skinny- you name it. If it doesn’t get eliminated it gets to stay around.
The entire debate is if organisms are designed to evolve or evolve by means of differing accumulations of genetic accidents, mistakes and errors.
Look you don’t have a mechanism capable of getting beyond populations of prokaryotes and that is given starting populations of prokaryotes. And you can’t account for basic biological reproduction. So yours is a non-starter.
Elizabeth:
Stop equivocating already. Intelligent Design is not anti-evolution so saying “evolutionary systems” is misleading.
There are many different species occupying the same ecosystems, ie have the same environmental pressures. So what does “intrinsic to the environment” mean? There aren’t any fish living in trees? Is that it, stuff like that?
Elizabeth:
Why don’t you and yours just ante up and show they are wrong by demonstrating the power of unguided evolution? You can criticize them all you want but until you actually have something it just looks like childish whining.
If any of the administrators are reading this, could you unblock my regular account (“Piotr”) and allow me to post under my real name? I’d appreciate it if I could take part in the discussion as myself. Just between us grown-ups, I don’t think I was guilty of any gross misdemeanour, and it sucks to remain banned for weeks only because somebody happened to be in a censoring mood.
Elizabeth Liddle asks:
Yes, absolutely. As I said in the OP “If anything is designing, it is the environment”.
Please test your concept that the environment designs, as opposed to just providing the triggers for “built-in responses to environmental cues”?
And after you do that please model the environment designing eukaryotes given populations of prokaryotes. (Of course it would be nice to see the environment producing replicators that can change)
Well, what I mean is: if the environment is doing the designing, as you say (and I agree) then it seems to me it is doing it by possessing a very simple property, that of scale-free variance.
And so to infer from this a designing MIND, the Ewert, Dembski and Marks would have to make the argument that that scale-free variance is an otherwise improbable property of a non-designed universe.
Which I don’t see them doing.
So what? science goes with what we know, not with what we don’t know. The design inference, as with ALL scientific inferences, is based on our current knowledge and ability to test. And yes that also means that the science of tomorrow can overturn the science of today. And guess what? It happens.
If you don’t like the design inference the power is in your hands to refute it. That is due to the explanatory filter that Wesley doesn’t seem to understand follows the mandate of science, ie Newton’s four rules of scientific investigation, also known as parsimony.
Chapter IV of prominent geneticist Giuseppe Sermonti’s book Why is a Fly Not a Horse? is titled “Wobbling Stability”. In that chapter he discusses what I have been talking about in other threads- that populations oscillate. The following is what he has to say which is based on thorough scientific investigation:
(snip a few paragraphs on peppered moths)
The point being, that IF it were left to direct scientific observations, evolutionism fails miserably and all that is left is wishful thinking supported by speculation.
Joe:
Who said eukaryotes were “designed”? Successful genomes absorb information (“how to survive and replicate”) from the environment just because the environment discriminates between viable and non-viable phenotypes. However, the environment does not generate the variability it acts on. Genomic changes don’t happen because there is a selective pressure. It’s adaptations, not mutations (sensu lato) that are “designed”.
Piotr- Can you follow along? The OP says the environment is the designer. You responded to me asking how to test that claim.
The environment did not design genomes. Yours doesn’t have a mechanism capable of explaining eukaryotes. It can’t even explain biological reproduction.
Adaptive change is the answer.
Who said it did? The environment doesn’t act on the genome directly. It only “informs” the genetic pool which alleles survive better (because the phenotypes they produce have some advantageous traits). A DNA sequence responsible for those traits does not even look “designed” by itself. Is this one designed or random, and how do you know?
ACATCCACACTTTGGTGAATCGAAGCGCGGCATCAGGGTTTCCTTTTGGATACCTGATAC
There are other factors beside selection. The usual sources of variation are unpredictable, random events. An endosymbiotic relationship may have started by chance. Mutations happen by chance.
A new environmental niche may arise by chance. A competing species may be wiped out by an accidental catastrophe.
However, if you have a given environment and a given genetic pool, what happens to the alleles in the pool is at least partly dictated by the environment. The sampling of alleles from generation to generation is biassed in favour of those that produce phenotypes better attuned to the environment. This is what produces an appearance of design.
The thread is about the Active Information concept proposed by Ewert, Dembski and Marks. Those three authors do not dispute that evolution can result in design.
What they argue is that it does so by means of Active Information.
Would one of the UD regulars like to defend this argument?
Don Pedro says,
The sampling of alleles from generation to generation is biassed in favour of those that produce phenotypes better attuned to the environment. This is what produces an appearance of design.
I say,
So in your view an artifact that is better attuned to the environment will more likely appear to be designed?
I’m not sure how that conforms with to our normal everyday design detection. I am much more apt to infer design in an object that inexplicably bucks the environment.
Think square corners verses smooth ones.
peace
And we are still waiting for Kairosfocus to define FSCO/I and clarify how it is related to “active information”. A computable metric would be better than an intuitive criterion such as “Methinks it’s like a fishing reel.”
Living things are not artefacts, and they don’t naturally occur in environments to which they are not adapted. Salmon don’t live in trees, and giraffes don’t live in Greenland.
And artefacts don’t, generally, self-replicate, so are incapable of forming an evolving population.
EL and DP said.
Living things are not artifacts and….. And artefacts don’t, generally, self-replicate
I say,
So you are saying that living things don’t exhibit the appearance of design?
Peace
EL says
What they argue is that it does so by means of Active Information.
Would one of the UD regulars like to defend this argument?
I say,
I’m not sure about defending the argument but I’d like to discuss it.
I think that a good way to think about Active information is…..
The information in an artifact minus the information in the algorithmic model that best approximates it together with any random noise.
I think that is a more promising approach than looking at probability.
peace
Non sequitur. They need not be artefacts to exhibit features which “make sense” in a given environment.
KF @39:
No, it isn’t.
The number of alternatives considered before reverting to a final default is completely irrelevant to there being a final default (as you almost certainly know), your vapid blathering about FSCO/I is even more irrelevant, and you are the one who’s been caught playing twisty games with definitions.
DP, you have had far more than you reasonably need for what is an abbreviation of a phrase that is itself a description, with examples, a framework going back to Orgel and an actual definition from Dembski, and links to much more. At this point it is obvious that you are playing a tiresome rhetorical game that is itself revealing when juxtaposed to what else is going on by way of abusive behaviour that such games enable. KF
DP says,
They need not be artefacts to exhibit features which “make sense” in a given environment
I say
So making sense in a given environment is what makes something appear to be designed?
I don’t understand
For me it’s is often when I see something that appears out of place that I infer design.
Is that not your experience?
peace
Roy, you are simply twisting language. When one has established alternatives and exhaustion of the alternatives backed up by trillions of cases of observed adequate cause, you are not reverting to a default. Period. What you are trying to do is to create the impression of inadequate basis for inductive inference to best empirically warranted explanation by playing silly word games. Juxtapose this with the ongoing abusive behaviour that such enables and the ugliness and emptiness of such ill-founded rhetoric stands revealed for what it is. KF
EL,
It is obvious that you need to be reminded yet again, after years and years, of what Paley put on the table over 200 years ago on additionality, in Ch 2 of his writing; moving on to the next level of the watch in the field argument . . . the aspect that I have never seen reasonably discussed by those who trot out the flawed analogy argument:
The objection collapses, has long collapsed in fact as this anticipated Darwin et al by 50 years and von Neumann by 150 years almost.
Now, multiply the above rhetorical tactics, madam, by the fact that you host one of the cluster of sites that harbours the set of abusive stalkers that are currently at their fell work.
Then, you may begin to understand that I take a dim view indeed of such enabling tactics above and elsewhere.
Good day, madam.
KF
fifthmonarchyman,
If so, life is not designed. Problem settled.
fifthmonarchyman said:
What I would say is that they exhibit some of the features of human design, but that they also exhibit features that are not typical (in fact very rare) in human design and which offer an alternative explanation to external design, namely the capacity to self-replicate with heritable variance in reproductive success.
They also show no signs of being designed for the purpose of an external designer. Contrast a watch (to take the classic example) with a cactus. The watch does not reproduce; the cactus does. The cactus’s design clearly serves the function of sustaining the cactus and assisting its reproduction. It serves no other obvious purpose. The watch’s design is of no apparent use to the watch, but, on further examination, serves a very important function for a quite different object, a person – an object, moreover with the apparent capacity to design and manufacture a watch.
So we have two objects, each of which have features that clearly serve a function. But in the case of the cactus that function is its own reproductive success, a function that itself accounts for it design. In the case of the watch, that function serves the purpose not of itself but of an external designer. So we can infer “external design” for the watch, and “evolutionary processes” for the cactus.
fifthmonarchyman wrote:
Peace to you too! But let me point out that Ewert, Dembski and Marks’ quantification of information is simply the log base 2 of a probability (where probability is a normalised frequency distribution). That is why I asked about probability.
KF: “EL…Now, multiply the above rhetorical tactics, madam, by the fact that you host one of the cluster of sites that harbours the set of abusive stalkers that are currently at their fell work.
Then, you may begin to understand that I take a dim view indeed of such enabling tactics above and elsewhere.
Good day, madam.”
KF, I am a little confused as to where this uncalled for rant came from. Elizabeth has been nothing but polite and fair in her comments on this thread yet you unjustly attack her in this manner. You demand respect and good behaviour from others but why should they give this to you when they see you make unfounded statements like this?
Piotr:
Too vague to be of any use.
Yours doesn’t have a mechanism capable of explaining eukaryotes. It can’t even explain biological reproduction.
Non-sequitur and you still don’t have a mechanism with the capabilities required.
Elizabeth:
Sure they do. They definitely don’t show any signs of being produced by mother nature.
Biological reproduction is evidence for Intelligent Design.
Peering into Darwin’s Black Box: The cell divsion processes required for bacterial life
Genomes exist and cannot be explained by mother nature, father time and some known or unknown process. Prokaryotes exist and cannot be explained by mother nature, father time and some known or unknown process. Eukaryotes exist and cannot be explained by mother nature, father time and some known or unknown process.
UP, I will explain in one word: enabling, as in TSZ blog owner and long term participant at the far less savoury sites. KF
But, as you will acknowledge, KF, one who has never borne you ill-will.
KF: “UP, I will explain in one word: enabling, as in TSZ blog owner and long term participant at the far less savoury sites. KF”
With respect, blaming the host of a blog for the behaviour of people who frequent her blog when they post on another site is rather a stretch, if not disingenuous. As a host, a person is responsible for the tone allowed by commenters. I must say, even though I don’t agree with many of the commenters at TSZ, I find that they do a fairly good job at allowing open and fair discussion of all sides. I must also say that there are many ID supporters at UD who behave deplorably. Being an ID supporter, I find this embarrassing.
If we hope to be taken seriously we have to stop misinterpreting criticism of our views as personal attacks.
DP says,
If so, life is not designed. Problem settled.
I say,
I’m sorry but life definitely appears out of place in a cold and barren universe don’t you agree?
And individual organic structures appear out of place in there environment. I would never expect a rotary engine to be propelling a bacterium or a high capacity pump fighting against friction and gravity at the core of the circulatory system.
EL says,
They also show no signs of being designed for the purpose of an external designer
I say,
If life does not appear designed why all the fuss? If there is no apparent design why is there a need to postulate a design mimicking mechanism?
EL says,
But let me point out that Ewert, Dembski and Marks’ quantification of information is simply the log base 2 of a probability (where probability is a normalised frequency distribution). That is why I asked about probability.
I say,
I would agree that information and probability are correlated the problem is in directly measuring probability.
That is why I would come at the problem from another angle. If you can quantify the information content in the artifact that is not algorithmically attainable you have indirectly measured it’s probability.
peace
EL: An evolutionary algorithm is not guaranteed to increase complexity over time. It’s possible for such an algorithm to get stuck on a local maximum of fitness, and basically never progress from there. In that situation, the evolutionary search is WORSE than blind search, because at least the blind search has a finite chance of reaching a new target, whereas the chance can be exactly zero for the evolutionary search. As KF has explained, the space of possible searches is a power of the size of the search space, and the vast majority of those searches will underperform the blind search, for reasons similar to what I just described. Even the vast majority of the subset of searches with evolutionary characteristics will underperform blind search.
Only a fantastically complicated and specific series of environmental events could produce the variety we see in life. For example lets say you wanted to turn a prokaryote in a Petri dish into a eukaryote. What would you do to the environment in that dish to make that happen? Vary light exposure? Vary temperature? Vary pH or other chemicals in the environment? Expose it to radiation? The tools that the “environment” has at its disposal seem many orders of magnitude too crude to achieve the transformation.
Your argument seems to be that the environment produces a special smooth search space. Picture a box of watch parts, and one person tries to build a watch with furious shaking, and the other tries to smoothly and carefully tilt the box to get the pieces to fall into place. Add the ability for the second person to occasionally tilt the box two different ways and keep the result closer to the correct state. Neither approach has any chance of building a functional watch. The tools are too crude! An environment might be possible to construct that would self build a watch (say an automated watch factory), but it would show up as a very precisely constructed device, not nearly as random and arbitrary as the natural environment.
Elizabeth Liddle @73:
EL, you’ve asked one of us to defend an argument. Do you think it reasonable that before we “defenders” go off in defense of some argument that we should agree on what the argument is?
When you say that evolution can result in design what do you mean?
Can you cite the three authors you mention in a way that substantiates your claim that they all three do not dispute that evolution can result in design?
NetResearchGuy: It’s possible for such an algorithm to get stuck on a local maximum of fitness, and basically never progress from there.
Recombination prevents an evolutionary algorithm from becoming stuck on plausible fitness landscapes.
NetResearchGuy: Only a fantastically complicated and specific series of environmental events could produce the variety we see in life. For example lets say you wanted to turn a prokaryote in a Petri dish into a eukaryote.
The environment includes biological organisms. The mechanism of eukaryote evolution included endosymbiosis.
Elizabeth Liddle claims that Ewert, Dembski and Marks do not dispute that evolution can result in design.
But is that true?
Take, for example, the following:
Elizabeth does not understand the argument and therefore is unable to produce a meaningful challenge calling for anyone here to defend it.
Zachriel:
The program does that.
Finally, Zachriel learned something.
That is the untestable claim anyway.
Joe: That is the untestable claim anyway.
You’re so cruel.
Elvis told us not to be, but I haz free will.
Elizabeth Liddle.
Nonsense.
Elizabeth Liddle:
More nonsense.
Elizabeth Liddle:
Reality calling!
Post your model, Elizabeth. Let it be tested. You know, Science.
What if prokaryotes came from eukaryotes? Say the eukaryote died but its super-mitochondria survived as free-living bacteria?
Can evolution make things less complicated?
I know, I know- it needs to be tested. It does show there is other explanations for the similarities between bacteria and mitochondria. To me the similarities are superficial in that a ring configuration is the most efficient way to package DNA- as compared to linear chromosomes.
Mark Frank:
Yet more nonsense.
Mark Frank
Indeed.
Liddle reminds me of someone who might be a decent science fiction writer or good story teller. But certainly demonstrates that over the top use of conjecture and unsupported assertions claimed as apparent scientifically substantiated information is all there is that has to argue with. Why is this?
Hail the rabbit trail queen!
Many apologies for not joining in the fray. My schedule is a bit packed at the moment, but I hope to come back to here soon.
johnnyb,
it’s ok. Aurelio Smith has had no response. You’ve missed nothing.
johnnyb writes
No problem, Jon. Some of us have real lives to lead and must fit our internet activity into the space available.
Mung:
Seems to me Aurelio Smith has had 112 resposes so far, though Aurelio Smith does not consider them all to be substantive.
Aurelio Smith will attempt to find time over the next day or two to pick up on substantive points raised in comments so far.
Jon Garvey writes:
One might say that aspects of environmental change are unpredictable. Some might say that God moves in mysterious ways. Once you have your population of replicating organisms, where the replication is not perfect, the non-random process of selection can sieve out the better exploiters of that environment.
Your question assumes that this process is teleological. Playing Devil’s advocate, I suggest that God can design us by designing the environment (with it’s kaleidoscope of constant change) to produce us (along with our parasites and every other organism).
But the question that interests me is whether DEM have, in proposing their concept of “active information”, produced or argued against a model that accurately represents what is proposed by the current theory of evolution.
SimonLeberge writes:
There seems to have been a change in emphasis since Dr Dembski began his collaboration with Dr Marks. CSI seems to have gone the same way as the explanatory filter.
SimonLeberge writes;
Am I right in understanding that “p” is needle and”q” is haystack?
Mark Frank writes:
I don’t think this is correct. Organisms live in the moment and to contribute their alleles to at least the next generation they already need to be fit enough to survive in their niche. They get on with living. Organisms are fixed, with regard to the genetic information they contain. the change that occurs over time is allele frequency. Populations change over time due to the survival or loss of alleles in populations of organisms.
indeed. It is a key misunderstanding to attempt to evolutionary processes as a search. Variation gets into the gene pool and either makes it into succeeding generations or doesn’t.
Elizabeth Liddle writes:
Exactly. The key postulate of evolution is that survival (at least to the point of being able to breed) is the selecting agent for the alleles that survive through generations.
It is possible that DEM’s work has other applications and applications.
fifthmonarchyman wrote:
I didn’t say that life does not “appear designed”. What I did so is that it does not appear designed for any other purpose than its own perpetuation. A screwdriver, for instance, looks designed for a person to hold in her hand and drive screws. A cactus does not look designed for any purpose except to survive and breed new cactuses.
There are few (and, until recently, no) human-designed artefacts that breed, and most human-designed artefacts look as though they were designed for some purpose other than their own perpetuation.
So I don’t think that biological objects look designed by someone else for that someone’s own purposes. I think they look designed to optimise their own perpetuation by means of survival and reproduction. And evolutionary processes do just that – result in entities optimally suited to survive and reproduce in the current environment, without need of external guidance.
Exactly. And that is something the Ewert, Dembski and Marks do not address with regard to Active Information. To derive a probability you need frequency data – we need to know how often Active Information of the kind required to “fund” an evolutionary “search” would be available under the null hypothesis of “no designer”. And we don’t know that, and Ewert et al don’t tell us how to find out.
So how would you do that?
Don Pedro/Piotr writes:
Excellent point. When ID methods can find the signal in the noise, it will be a momentous achievement. That day is not here yet.
ETA All I have time for till later
Who can tell by looking at a binary file of 1′s and 0′s if the data has meaning? But when interpreted it can be music, an image, a video, text or even a combination of these.
Aurelio Smith wrote:
Yes, indeed. CSI doesn’t work. After all, a sine wave can contain a large amount of Shannon information (be very long) but be algorithmically very simple, but plenty of processes produce sine waves without suggesting that they have been designed. So then you have to resurrect the filter – we “know” that sine waves weren’t designed. And so the argument becomes: the signature of design is a pattern that is algorithmically simple, large, and generated by an unknown process. Which doesn’t tell you anything other than that the process is unknown!
So Kolmogorov exits, and we are back with simple differences between logs of probabilities.
But that won’t tell us whether difference between the log of the probability of finding a “target” under some null (e.g. random search) and the log of finding it under some algorithm (e.g. an evolutionary search) represents anything to do with design. It just tells us that some searches work better than others. Calling the log of the probability differential “Active Information” doesn’t tell us that it came from a Mind, any more than taking the log of any probability turns it magically into Information in any sense other than a mathematical one.
The underlying implication seems to be that Dembski et al have fallen back on the Fine-Tuning argument: that a universe in which evolutionary searches are possible is itself improbable. Which I think is the position held by BioLogos, isn’t it?
Mung wrote:
Well, no. As I understand that passage, Ewert et al are saying that yes, evolutionary models work, but they do so by virtue of Active Information.
In a computer context, clearly that Active Information is provided by the designer of the model, who does not provide the solution (otherwise there would be little point in running the model) but does design the environment in which the virtual organisms evolve to thrive in. This environmental function is the Active Information provided by the model – it’s the feedback that “tells” the population of virtual organisms whether it is “warm” or “cold”.
Nobody is arguing that evolution doesn’t require such feedback, so if that is all Ewert et al are saying, they are saying nothing new. However, if they want to then make the leap of saying that such information MUST come from a designing mind, then they need to make that argument, because it is not obvious that a natural environment, complete with hazards and resources, must be the result of a Designer. In fact, it would be an odd switch of argument, from “living things are complex, therefore Design” to “the environment is complex, therefore Design”.
As I said, it seems to imply a reversion to the Fine-Tuning argument of BioLogos.
Mung wrote:
Yes indeed. If someone would like to summarise what they think Ewert, Dembski and Marks are saying in the cited papers, that would be great.
Yes, your own quotation makes this point – that evolutionary search results in design (i.e. in a the “finding” of a “target” with greater probability of success greater than random search) – but by virtue of Active Information.
In other words – it works, but by virtue of the insertion of “Active Information” into the process.
So let’s talk about where that Active Information comes from in the context of biology. Aurelio, and I, and others, argue that it comes from the environment, which is exactly where it also comes from in a computer context – the “virtual environment” that the “virtual organism” inhabit.
Aurelio Smith says.
There seems to have been a change in emphasis since Dr Dembski began his collaboration with Dr Marks. CSI seems to have gone the same way as the explanatory filter.
I say,
The three concepts are simply different aspects of the same phenomena.
CSI looks at the problem from the perspective of the artifact itself
The explanatory filter looks at the problem from the perspective of the specific process that produced the artifact
Active information looks at the problem from the perspective of the overall environment that forms the context for the process that produced the artifact.
Three different ways to get at the same nugget
This triperspectivalism convinces me that the man is on to something profound.
peace
EL
This is not business as usual anymore. I have been subjected to web stalking for years on sites you host and participate in, harboured on flimsy excuses about freedom to speak; ignoring the obvious focus on hostility laced harassment and character assassination based on snipping and twisting words as well as outright fabrications. I won’t bother on the usual rhetoric of deflection and dismissal here. Now, it is reaching evident on the ground stalking involving people connected to me in rather remote degrees.
The pretence that such if mere freedom of speech is now utterly threadbare and transparent.
Further to this, within 24 hours of my having to process that very serious development in two venues, along you come waltzing in here to back up a post that obviously (by convenient topic) particularly targets me by focussing on themes I have been particularly associated with. And seemingly as if nothing serious is going on that has created a serious strain.
Sorry, I was not born yesterday.
With all due respect, I think you have some explaining to do, and some homework in what you host and where else you have been a long time participant. Hence my closing remarks above after dealing with years long sustained refusal to deal with cogent, 200+ years standing matters regarding the flawed analogy dismissive rhetorical gambit.
Good day, madam.
KF
PS: UP, Over years there has been a serious problem with things that have been hosted at TSZ, and that site, per fair comment has long been what we used to call a front operation regarding Marxists, for several far less savoury sites. Those are the sites I also spoke to above. Enabling behaviour and de facto front operations are not minor matters to be ignored or white washed; as many are re-learning today on even bigger global issues. As Mao Zedong used to put it, the Communist guerrilla-agitator is the fish swimming in the sea of the general population that provides the cover/front/ face card, support, enabling etc.
5th, you are correct. But, you are dealing with those who will try to find anything to latch on to to manufacture a dismissive objection. KF
ME before: That is why I would come at the problem from another angle. If you can quantify the information content in the artifact that is not algorithmically attainable you have indirectly measured it’s probability.
EL before So how would you do that?
Me now
Well it will require a bit of “splaining”.
Design is nothing but the physical approximation of an already existing archetype in the designers mind.
It’s the flip side of information integration. With integration you take data and compress it into a shorter form in such a way that it can be reproduced faithfully with out loosing any information. Design on the other hand is the physical approximation of preexisting compressed data.
So all we really need to do is verify that an perceived target is indeed a lossless data compression of the existing artifact and the rest is pretty strait forward.
IIT has already provided a method of quantifying the information that is not algorithmically attainable with such a lossless data compression.
Check it out http://arxiv.org/pdf/1405.0126v1.pdf
peace
UP,
Perhaps, I should in addition put this Alinsky style (as his particular forms are most in evidence today), the population must become the manipulated, polarised passive enablers for the radical activists and to do so must be led to believe all/only angels are on one side and all/only devils are on the other.
The use of character assassination and slander or scapegoating targetting of institutions to that end is a notorious, studied tactic. So are mob rule tactics that exploit freedoms to push the envelope farther and farther by degrees until there is eventual toleration for the most ugly targetting of designated scapegoats. As is of course the associated setting up and smearing then setting alight of strawman caricatures of people, institutions and arguments that then cloud, confuse, poison and polarise the atmosphere.
One thing I am therefore doing — given highly suspicious timing, focus and surfacing — is pointing out that the atmosphere has now been seriously poisoned, and those with responsibility and the prestige required to run front operations or serve as enabling face cards . . . I am being forced to revert to terminology from the past . . . have a certain responsibility to seriously clean house and put out the burning poison-laced strawmen.
Including, where they persist in endlessly repeating fallacious, tainted and dismissive talking points regardless of correction as though nothing is wrong.
(I must add that there is a direct involvement of such a talking point involving specifically EL as a face card on oh Aiden and their atheist’s anthem and associated vampire clergy supporting war mongering and genocide video etc are as pure as driven snow, in the attempt to smear me at the local newspaper’s web site; though now the worst smears put up there have been removed by Editors as they constitute blatant character assassination tort. Let’s just say that the notion that I would consort with criminals [in particular, murderers . . . ] rather than support rehabilitation of former criminals in the business place of remote relatives or friends [I freely "confess to the latter . . . ] is a particularly nasty bit of speaking with disregard to truth in hopes that what is said or suggested will be taken as truth to my severe disadvantage; including attempting to box bread out of the mouths of my family. And of course, that I am in fact linked by in-law relationships to such persons is local, not on the Internet information implying on the ground stalking and casing of the joint involving uninvolved relatives of not just close but remote degree.) The UD editors have the actual smears in hand which I believe is part of why they were so firm with enablers in another recent thread.)
I suggest you go here to see where this sort of ruthlessness can eventually get in the hands of activists wielding power if unchecked: http://kairosfocus.blogspot.co.....h-258.html (The expelled phenomenon is a milder more subtle, but quite vicious form of this.)
KF
KF: this OP does not target you.
It is a post about papers by Ewert, Dembski and Marks, and a friend of mine emailed me to say that Aurelio Smith had been invited to do a guest post on the subject, and that former banned posters were no longer banned here. So I posted, and in fact, in at least one of my posts, expressed agreement with a point you made.
Please stop assuming the worst.
ETA: re your edit. TSZ is not a front for Marxists. It is not a front for anything. It is a blog site, owned by me, which serves as a discussion site on topics we are both interested in. You are welcome to post there, as I have told you many times.
fifthmonarchyman wrote:
Thanks for the link! But I’m not following your argument. I don’t see how your definition of design gets us very far, and I’m not sure how good it is anyway. Most designing (and I speak as a trained designer, as it happens!) isn’t “the physical approximation of an already existing archetype” in anyone’s mind. Take a building (my training was in archecture) – it often starts as a (literal!) “back of the envelope” sketch of an idea. The final building may owe its origin to that initial sketch, but far from being an “approximation” to an “already existing archetype”, it has been fleshed out as a continuous process of trial-and-feed-back, with many design decisions made on-site, often, as unforeseen problems emerge. With CAD, this is less often the case, but the same applies to the finished CAD prototype – it has emerged from a process of trial-and-feedback, for example, from new information from the client, or unanticipated site problems, or the costs of materials.
And in that sense, the design of living things is similar – it emerges (under evolutionary theory) from a trial-and-feedback process. The difference is that in evolution, you don’t need an architect, because the trial-and-feedback process is built-in to the basic property of biological organisms, namely their capacity to reproduce with heritable variation in reproductive success in the current environment.
And it is that feedback from the environment that constitutes the Active Information in Ewert, Dembski and Marks’ formulation. In computer models, the human designer doesn’t design the evolved population of solutions, but she does design the environment, usually in such a way that the evolved solution will be one to a problem she actually wants to solve. But it doesn’t have to be that way. I’ve written evolutionary models with randomly selected fitness criteria – and the virtual population evolves to optimally thrive in that environment.
And I suggest, as does Aurelio, that this Active Information – the feedback from the environment to the evolving population – does not have to come from a mind. It is simply inherent in the hazards and resources that are locally present.
Unless the argument is that only a mind could produce environments with that much variation in hazards and resources, and with sufficient temporal and spatial smoothness. But that is not the argument I see being made.
KF wrote:
I cannot make head nor tail of this, although I assume I am the “EL” referred to. You can find my email address fairly readily (ask Barry for it if you cannot access it yourself), so I suggest you detail the problem you think I am responsible for in an email and I will try to sort it out.
EL says,
it often starts as a (literal!) “back of the envelope” sketch of an idea. The final building may owe its origin to that initial sketch, but far from being an “approximation” to an “already existing archetype”, it has been fleshed out as a continuous process of trial-and-feed-back, with many design decisions made on-site, often, as unforeseen problems emerge.
I say,
The back of the envelope sketch is the archetype the “trial and feedback” you describe are just the technical details of how the original archetypical idea is actualized.
You are confusing the actual messy act of physical approximation with the design itself. Conceptually It makes no difference whether a sculpture is made with a hammer and chisel or 3-D printer.
A circle is simple to conceive of but messy to actualize. Actualization is not design it’s production.
That is the whole problem with evolutionary explanations for the design we see it is like trying to explain the existence of a circle by talking about the action of the scissors.
peace
KF:
KF’s quoted definition:
Establishing something by eliminating alternatives is, by definition, establishing it by default.
As for “trillions of cases of observed adequate cause “, that’s horse-apples. There isn’t even a single observed cause of Dembski’s intelligent design, adequate or otherwise.
KF highlighted the wrong definition of ‘default’ w.r.t. Dembski’s design filter, and while that might have been through incompetence (either at deception or in general), the subsequent attempts at weasel-wording and attention diverting are definitely intentional.
ID will never prosper while it’s most vociferous advocates evade responsibility for their dumb mistakes.
Again I think IIT provides a way forward. You and I may have come to integrate the concept of pi in vastly different ways you might have learned it in a Geometry book and I might have discovered it by pondering a baseball.
But the “target”/specification/nonlossy compression that is Pi is common to both of our understandings,
peace
AS
#116
Not exactly. q is the probability of finding the needle without any help, p is the probability of finding the needle when you know a bit about where it might be in the haystack. Nevertheless you are right that p should be greater than q (actually it is interesting to think about the case where we have a search strategy that has been misled into being worse than random – where presumably the active information is negative!).
But these are all probabilities of success given a search strategy. To turn that round and talk about the probability of a search strategy given a success without using Bayes requires some heroic assumptions.
#117
Fair enough.
EL says,
And it is that feedback from the environment that constitutes the Active Information in Ewert, Dembski and Marks’ formulation.
I say,
The reason that Active information must come from the environment is because it can’t come from the evolutionary algroythym.
That is the point
It’s not about the ability of the environment it’ about the deficiency of the algorithm.
peace
F/N: I will pick up just one, slice of the cake has in it the ingredients of the whole talking point that caught my eye; EL at 122:
1 –> Strawman tactic rubbish, we are NOT discussing sine waves or empty Shannon metrics but Wicken wiring diagram, functionally specific complex organisation of parts to achieve particular function and thus tightly constraining possible configs relative to the config space of possible clumped and/or scattered configs.
2 –> That is why the metric I have had to draw out from Dembski, justify empirically and explain correctively to EL over and over again . . . and yes, we see further how the suspiciously timed intervention implicitly tries to put me on the back-foot at the crease, in cricketing terms . . . works reliably (it is in fact an algebraic form of the explanatory filter that she would also dismiss):
Chi_500 = I*S – 500, in bits beyond the solar system threshold.
2 –> That is an info metric tied to I = – log p [or to the comparable direct counting/observation of state storage possibilities] is multiplied by an observationally based dummy variable S.
3 –> S — as has been pointed out correctively ever so many times across literally years, just studiously ignored as usual — defaults to 0 implying chance and/or necessity are adequate causes so far as we can tell and is only set to 1 if there is positive empirical reason to see that the information-bearing configuration in question on this aspect of the object or phenomenon etc, is specific in ways that tie it to a narrow zone T in a wide field of possibilities W.
4 –> Where also, for a wiring diagram config, a structured sequence of Y/N q’s suffices to describe the specific arrangement and quantifies the information through the length of the string of bits so created. This is of course directly related to Kolmogorov complexity metrics AND is the commonplace phenomenon we see with AutoCAD files and the like.
5 –> This, too, has been pointed out repeatedly, year after year, exchange after exchange, only to be predictably talked past in classic ignore or caricature and dismiss the counter-point fashion.
6 –> Fairly recently, and as was cited by me at 19 above but of course ignored and/or caricatured and brushed aside, we have obtained copies of Orgel’s 1973 book, and have confirmed the following extended form of the clip from 1973 that has been on the table for years:
7 –> So, the quantification, I*S is reasonable. Just by the fact that something is info-bearing, it is highly contingent, and just by the functional context and wiring diagram specificity to achieve particular function, it is not only not credibly a product of mechanical necessity a la F = m*a, but . . .
8 –> it is now a candidate for sufficient complexity joined to functionally specific organisation that it is maximally implausible that blind chance by itself or acting with mechanical necessity could reasonably find such a deeply buried needle in such a big haystack.
9 –> Thus, we introduce a test threshold. In the case in view above, 500 bits setting a threshold where the 10^57 atoms of our sol system acting as explorers of possibilities and observers manifesting the consequences at 10^13 – 14 times per second [a fast chem rxn rate], could only explore as one straw to a cubical haystack comparably thick as our galaxy. For the observed cosmos as a whole 1,000 bit would be even more conservative.
10 –> Thus, Chi_500 = I*S – 500, in bits beyond the solar system threshold.
11 –> Compare this to the strawman caricature erected above, knowing that just in recent weeks and months things like this have been repeatedly headlined (but have been brushed aside or studiously ignored):
http://www.uncommondescent.com.....-relevant/
12 –> Before moving on, I should make a further corrective: the brief/simple description of why something is functionally specific, is to be distinguished from the informational metric that indicates the degree of complexity involved. In short, to say, Abu 6500 fishing reel is a simple description, but just the specification of its main gear carries you rapidly past 500 bits or 72 ASCII characters.
13 –> Likewise, to say cellular protein synthesis process or wider cellular metabolism or the like, is not equal to the quantification of information involved in its functionally specific organisation. Which is actually a wide body of info with Nobel prizes involved.
14 –> So, there is no circularity there to point to the two distinct things.
15 –> Nor, is it question-begging to point out that on trillions of cases in point FSCO/I is reliably observed to have intelligently directed configuration — aka design — as its adequate cause AND that there are zero credible instances of FSCO/I created by blind chance and mechanical necessity in our observation.
16 –> Blowing aside the toxic smoke of burning tainted strawmen for a moment, the vera causa plausible, empirically warranted inductive inference to best explanation per reliable sign, for entities exhibiting FSCO/I, is therefore design.
17 –> Further to this, those who object have a duty of warrant to show by plain, credible observed cases, that such FSCO/I is reasonably and adequately caused by blind chance and mechanical necessity without intelligently directed configuration.
18 –> It is notorious that there are zero cases of such, after years and dozens of attempts here at UD, elsewhere and of course on YouTube. For instance the canali of mars in the SKETCHES of 100 years past, were designed by astronomers to represent what they perceived. Had such entities exhibiting FSCO/I been observed in actuality on the ground on Mars, they would have been conclusive proof of a Martian civilisation. (And yes, that was one of many attempts. As a second the man who put up a YT vid on clocks evolving from pendulums and wheels does not have a clue about the FSCO/I involved in creating, aligning and organising complex gearing and machinery, etc. And yes, that was another case.)
19 –> So, the resort in recent years to obfuscatory and toxic rhetoric and linked ruthless activism fronted by organisations and face cards is a back-handed admission of failure to meet the vera causa test . . .
20 –> that, before one extends explanatory constructs to traces of the remote unobservable past of origins, one should first demonstrate causal adequacy of proposed explanatory factors through observations in the present.
21 –> To fail to do that is to beg big questions, begged questions that have been backed by ideological imposition of a priori materialism in the guise of mere plausible methodological constraints that avoid god of the gaps fallacies etc. (Clip to follow.)
22 –> In that context, to use language that suggests the explanatory filter is dead and is in need of a miracle of resurrection is a capstone example of obfuscation, strawman caricature and rhetorical dismissal tied to gross question-begging.
________________
That is most definitely not good enough. Especially when accompanied by surfacing and firing rhetorical torpedoes at a time and with a focus that are highly suspicious given what is now on the table.
I trust this slice of the cake with the ingredients in it will provide enough food for thought for the moment.
The one two punch of character assassination quickly followed by Bill Clinton’s take away their strong point in the follow on strike, fails.
Fails, because it exposes the utter disregard for soundness and fairness that have for far too long characterised far too much of the activism opposed to design theory.
KF
PS: And those who wished to go on to suggest that the people of this country should suspiciously scrutinise paying money for policy advice from such a disreputable and incompetent character [in attempted distraction from my initial response to abuse of parliamentary immunity regarding defamation . . yes, THAT is more of the context behind what is going on], should recognise from the hints above that I do have a modicum of relevant background and capability. (Here is a sampler, for the interested onlooker.)
fifthmonarchyman wrote:
Well, that’s what I’m disputing. I don’t think it’s how most creative people work. I think they start with an idea, not an archetype, and hone it through a give-and-take process of development, and, often, interaction with practicalities (problems often prove inspirational) until there’s a finished product of some sort – which often then undergoes further tweaking. That’s why engineering design is an interative process, with prototype after prototype undergoing testing and modification. So I’m still not persuaded by your premise!
I agree. And if all you are saying is that the finished artefact is never as good as the ideal, you might, or might not, be right. I don't think you are, actually. I think it's often better than the original concept – and in any case, it is what it is. A design is only as good as its implementation.
But a circle is not a design. You can make a design with circles, but “circle”, qua archetype, is a mathematical concept, not a design.
I don’t think this is true. Evolutionary theory simply explains how, given a popuulation of self-replicators who replicate with heritable variance in reproductive success in the current environment, that population will tend to evolve in such a way as its members are optimally equipped to survive and breed within that environment.
The only Active Information required is feedback from the environment, which is intrinsic to the process.
fifthmonarchyman wrote:
Well, it depends which part of the process you are labelling as the “evolutionary algorithm”. If we regard population of virtual organisms as the algorithm, then it takes input from th environment (the Active Information) and outputs a quantity of selected offspring, including near variants.
But yes – that’s the source of the input – the feedback.
Not really – it’s not a deficiency in the theory,which includes both the evolving critters (the organisms, which replicate with heritable variance) and the environment, which has properties that determine which variants are most, and least, likely to go on to breed.
You are correct that a breeding population of self-replicators will not evolve to fit an environment unless there is feedback from the environment, but that is the same as saying that a population of self-replicators will not evolve unless the variants it produces affect reproductive success in that environment.
Which is true. But why should that be a problem? It is pretty clear that in a given natural environment, some variations in biological features will affect reproductive success – fur colour, for instance, or beak depth, or toxin-production rate, or length of leg.
There is no shortage of such information in the environment, and no reason to think that biological populations won’t be affected by it.
PPS: Here is the evolutionary materialist scientism institutional and socio-cultural agenda as was publicly inadvertently exposed by Lewontin in NYRB, Jan 1997:
__________
>> . . . to put a correct view of the universe into people’s heads we must first get an incorrect view out . . . the problem is to get them to reject irrational and supernatural explanations [--> notice the loaded associations, cf my reply to the very same AS here and here on his accusatory, caricaturing, stereotyping and scapegoating rhetoric that targets ethical theism and theists . . . yes, newbies, this is high context stuff in which we are dealing with people with notorious track records and associations . . . just they crossed a big line with stalking and I am in full stand my ground mode this morning, as is written into the war cry-name they would so disrespect, trash and abuse; I have every intent to live up to it . . . ] of the world, the demons
that exist only in their imaginations, and to accept a social and intellectual apparatus, Science, as the only begetter of truth [[--> NB: this is a knowledge claim about knowledge and its possible sources, i.e. it is a claim in philosophy not science; it is thus self-refuting]. . . .
To Sagan, as to all but a few other scientists, it is self-evident [[--> actually, science and its knowledge claims are plainly not immediately and necessarily true on pain of absurdity, to one who understands them; this is another logical error, begging the question , confused for real self-evidence; whereby a claim shows itself not just true but true on pain of patent absurdity if one tries to deny it . . ] that the practices of science provide the surest method of putting us in contact with physical reality [--> notice the suggestion of the a priori materialism to follow], and that, in contrast, the demon-haunted world [--> loaded contrast of "reasonable" scientists vs followers of imaginary demons reduced to demonic irrational barbarism and superstitious opposition to progress] rests on a set of beliefs and behaviors that fail every reasonable test [[--> i.e. an assertion that tellingly reveals a hostile mindset, not a warranted claim] . . . .
It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes [[--> another major begging of the question . . . ] to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute [[--> i.e. here we see the fallacious, indoctrinated, ideological, closed mind . . . ], for we cannot allow a Divine Foot in the door. [--> The God of ethical theism, and especially the Judaeo-Christian tradition, is by implication, the chief imaginary demon of superstition and irrationality to be got rid of and his barbarians must be quarantined off from influencing education, science, policy, law and government, being utterly crushed and discredited in the culture at large by any means deemed necessary. Lewontin is too genteel to say that or associate directly with it but he is an enabling face card and has handed the agit-prop activists and thought police the ammunition and cover they need. That pattern should give us very serious pause indeed, especially when we see what else AS has been up to in and around UD.]
[ “Billions and Billions of Demons,” NYRB, January 9, 1997. Bold emphasis and notes added. If you have been misled by counter-talking points to imagine that this is "quote-mined" . . . i.e. deliberately distorted to mislead (which, newbies, is a further piece of character assassination that has been routinely used by the ilk we are dealing with here) . . . I invite you to go to the linked fuller annotated citation.]>>
__________
To be fore-warned is to be fore-armed. If, we are wise.
EL, and the beat of repetition of talking points goes on as though it is business as usual. Not anymore, it ain’t. KF
PS: For starters, you need to start with Darwin’s warm pond of salts etc struck by lightning or the like and by observationally anchored steps that pass vera causa, get us to an encapsulated, smart gated metabolic automaton with a codes and algorithms using von Neumann kinematic self replication facility. That is the root of macro evo icon no 1 from Origin of Species on, the tree of life. No roots, no shoots and no branches. Then, by similar standards account for OO body plans. This is of course the coming on three years standing pro darwinism evolutionary materialism essay challenge that was issued here at UD. It is a matter of patent record that for all that time there has been no serious response from you and your ilk. Where, the reason is patent: you cannot meet it. So, I say, no roots, no trunk no main branches, no tree to support the twigs and leaves. After that, all else becomes ideological posturing in the context of the agenda Lewontin inadvertently exposed. And, let me go on to a much earlier expose or three.
EL says,
But a circle is not a design. You can make a design with circles, but “circle”, qua archetype, is a mathematical concept, not a design.
I say,
I think this is a key point of disagreement. Do archetypes exist out there somewhere independent of the brains that ponder them like mathematical concepts?
I think they do. In fact I think that when we infer design we are simply recognizing a familiar archetypical pattern in a physical medium.
That is what all the talk about targets is getting at. We recognize the archetype behind the messy approximation we see in front of us
I would say that if there was not some sort of objective reservoir of archetypical Forms we could not even communicate.
There has to be some sort of objective meaning behind the various flashing pixels we see that you and I can both access or we would be talking to ourselves.
you say,
Evolutionary theory simply explains how, given a popuulation of self-replicators who replicate with heritable variance in reproductive success in the current environment, that population will tend to evolve in such a way as its members are optimally equipped to survive and breed within that environment.
I say,
Exactly, and as such it says nothing about whether a particular “target” will be reached.
A pair of scissors can cut any number of shapes some recognizable some not. You can’t explain circles by appealing to scissors. To explain circles you need to look beyond mechanism to mind.
peace
EL said:
So, where’s the research or math that shows that the active information available from naturally-occurring environments can plausibly account for the generation of the kind of diverse bio-machinery we observe by acting on stochastic variation given a start from a simple self-replicator in a certain environment?
Assertions of bare possibility aren’t really worth much in an argument.
F/N 1: Longstanding expose no 1, Cicero c 50 BC (this is the lead cite for my always linked note through my handle, onlookers):
____________
>> Is it possible for any man to behold these things, and yet imagine that certain solid and individual bodies move by their natural force and gravitation, and that a world so beautifully adorned was made by their fortuitous concourse? He who believes this may as well believe that if a great quantity of the one-and-twenty letters, composed either of gold or any other matter, were thrown upon the ground, they would fall into such order as legibly to form the Annals of Ennius. I doubt whether fortune could make a single verse of them. How, therefore, can these people assert that the world was made by the fortuitous concourse of atoms, which have no color, no quality—which the Greeks call [poiotes], no sense? [Cicero, THE NATURE OF THE GODS BK II Ch XXXVII, C1 BC, as trans Yonge (Harper & Bros., 1877), pp. 289 - 90.] >>
____________
Yes, on record since then and in some aspects before then, Plato in The Laws, Bk X, 360 BC:
The challenge on the table is longstanding and has always been unmet by materialism advocates. What is happening in our day is an ideologically driven institutionally enforced lock-out of alternatives, dressed up in the lab coat.
So, it seems someone has now cried havoc and let slip the dogs of ruthless agit prop ideological war.
This target of that attack is not going to go quietly into the night. Or, literally, I would not be worthy of my name — the name such mock and would besmirch — and linked ancestry. A thousand years deep.
KF
F/N2: As I headlined a few days ago, the same Cicero, at one ant twenty years, in the opening words of On Invention, spoke to warn against the destructive power of rhetoric in service to the ruthless mad march of folly . . . as now plainly stalks our civilisation:
__________________
>> I HAVE often and deeply resolved this question in my mind, whether fluency of language has been beneficial or injurious to men and to cities, with reference to the cultivation of the highest order of eloquence. For when I consider the disasters of our own republic, and when I call to mind also the ancient calamities of the most important states, I see that it is by no means the most insignificant portion of their distresses which has originated from the conduct of the most eloquent men. But, at the same time, when I set myself to trace back, by the aid of written memorials and documents, affairs which, by reason of their antiquity, are removed back out of the reach of any personal recollection, I perceive also that many cities have been established, many wars extinguished, many most enduring alliances and most holy friendships have been cemented by deliberate wisdom much assisted and facilitated by eloquence. And as I have been, as I say, considering all this for some time, reason itself especially induces me to think that wisdom without eloquence is but of little advantage to states, but that eloquence without wisdom is often most mischievous, and is never advantageous to them.
If then any one, neglecting all the most virtuous and honourable considerations of wisdom and duty, devotes his whole attention to the practice of speaking, that man is training himself to become useless to himself, and a citizen mischievous to his country; but a man who arms himself with eloquence in such a manner as not to oppose the advantage of his country, but to be able to contend in behalf of them, he appears to me to be one who both as a man and a citizen will be of the greatest service to his own and the general interests, and most devoted to his country . . . >>
__________________
And, yes, I must speak one more, again in the voice of Plato.
We must understand what is at stake.
And what those who champion folly would drive out into the wilderness, scorned and scapegoated.
Something that, again, the agit prop activists and their enablers, fronts and face cards have no answer to.
Year after year.
KF
F/N3: Plato warns in no uncertain terms in the same passage in The Laws Bk X:
____________________
>> Ath. . . .[The avant garde philosophers and poets, c. 360 BC] say that fire and water, and earth and air [i.e the classical "material" elements of the cosmos], all exist by nature and chance, and none of them by art . . . [such that] all that is in the heaven, as well as animals and all plants, and all the seasons come from these elements, not by the action of mind, as they say, or of any God, or from art, but as I was saying, by nature and chance only [ --> that is, evolutionary materialism is ancient and would trace all things to blind chance and mechanical necessity] . . . .
[Thus, they hold] that the principles of justice have no existence at all in nature, but that mankind are always disputing about them and altering them; and that the alterations which are made by art and by law have no basis in nature, but are of authority for the moment and at the time at which they are made.- [ --> Relativism, too, is not new; complete with its radical amorality rooted in a worldview that has no foundational IS that can ground OUGHT.] These, my friends, are the sayings of wise men, poets and prose writers, which find a way into the minds of youth. They are told by them that the highest right is might [ --> Evolutionary materialism -- having no IS that can properly ground OUGHT -- leads to the promotion of amorality on which the only basis for "OUGHT" is seen to be might (and manipulation: might in "spin")], and in this way the young fall into impieties, under the idea that the Gods are not such as the law bids them imagine; and hence arise factions [ --> Evolutionary materialism-motivated amorality "naturally" leads to continual contentions and power struggles influenced by that amorality at the hands of ruthless power hungry agendas], these philosophers inviting them to lead a true life according to nature, that is,to live in real dominion over others [ --> such amoral factions, if they gain power, "naturally" tend towards ruthless abuse], and not in legal subjection to them. >>
_____________________
What more can I say for the moment than this, that to be fore-warned is to be fore-armed. If, we are wise.
KF
Aurelio:
They both work fine and they are more than your position has.
Equivocating Liddle:
Please reference this “evolutionary theory”. And please show us these optimally equipped organisms and demonstrate how unguided processes did it.
All you have are your bloviations, Lizzie. Some day you will need evidence to support what you say.
Liddle:
There isn’t any “evolutionary theory” and there isn’t any evidence that unguided processes can do what is required.
Do you know anything about science, Lizzie? Apparently not.
Elizabeth:
CSI works. You just have no idea what you are doing. And please reference these alleged processes that can produce sine waves. According to SETI if they receive a sine wave they will infer ET sent it.
Joe, cf 138 supra for a point by point on CSI and linked themes: http://www.uncommondescent.com.....ent-560934 KF
kairosfocus- They don’t know how to use it so they dismiss it. Good tools in the wrong hands is not a pretty site.
Roy:
Wrong. If you actively consider alternatives then there isn’t any default. Learn how to use a dictionary.
Dembski, Ewert and Marks have been much to kind for evolutionism, for one thing the unlikelihood of preservation of homeostasis needs to be factored in.
Under materialism an organism is nothing but a bag of chemicals. Now one of the defining features of life is the unexpected balancing act that these chemical processes perform. The unexpected unity of it all. Miraculously, especially from a materialistic point of view, an organism doesn’t fall apart — on the contrary it ‘self-organizes’ — until the moment of death.
An evolutionist may argue that this is ‘explained’ by the most basic selection process of all: “existence”. IOW we don’t observe organisms that fall apart because all those who did are out of existence.
// Note that the balancing act is not a static equilibrium. It is a fluid shifting from one equilibrium to the next. It’s safe to say that during the life of a single cell, the cell is never the same. //
Now, let us take the materialist’s word for it! Let’s factor in the chance that the balance between the innumerable chemical processes is preserved during a search. Each new external or internal (mutation) change is a potential threat for the balancing act. For every external (environment) and internal change (mutation), goes that an organism is unlikely to be ‘ready’ for it, since it cannot have been selected for.
The Darwinist may object that this is not in accord with what we actually see, that organisms are more resilient to new influences than may be expected from a ‘bag of chemicals’. So much the worse for their materialistic view on life.
If homeostasis is to preserved, the “wormholes” through the fitness landscape — e.g. from land animal to whale — need to provide a path that is sequenced in such a way that the delicate balancing act of the bag of chemicals is not disrupted. When traversing the wormhole, all the new mutations, all the change in environment has to be somehow in perfect accord with the balancing act.
In short: to be able to traverse the wormhole the organism needs information for a continued adequate homeostasis (robustness). Where does it come from? The law of conservation of information
informs us that the information needs to be accounted for.
Can we measure homeostasis? How many mutations is an organism likely to handle? How much changes in the environment can an organism likely handle?
Note that what I really would like to measure is: How many mutations can a ‘bag of chemicals that happens to be in a balance’ likely handle? How much change in the environment can ‘bag of chemicals that happens to be in a balance’ likely handle?
Conclusion: Not only does the Darwinist need to account for all the information for the reconstruction from land animal into a whale, but he also needs to account for all the information that regulates homeostasis during the entire trip through the wormhole.
IOW there is also a search for an extremely balanced search, which additionally needs to be factored in. The fitness landscape is riddled with treacherous slant planes, high concrete walls and deadly gaping holes.
fifthmonarchyman said:
Maths won’t tell you whether a “bare possiblity” can “plausibly” account for real world events. You’d have to actually devise a hypothesis testable on data. Many such hypotheses have been devised, and tested – but we can never know for sure that any one theory is adequate. What we can do is demonstrate, mathematically in this case, that certain classes of mechanism can account for certain outputs. And we can demonstrate readily, by means of computer simulations, that, starting from a population of self-replicators in an environment containing both resources and threats, that that population will adapt – including acquiring quite complex features – in such a way as to optimise its reproduction rate within that environment.
Saying that such a simulation includes “Active Information” is not an argument against the case that such a process could occur naturally, because ecosystems contain precise analogues of all the features of the simulation: a population of initially simple self-replicators that reproduce with heritable variance and an environment in which there are both resources and threats.
And the source of that Active Information, in Nature, is the environment itself.
Now, you could argue that the environment doesn’t provide enough of such information (but Ewert et al don’t argue this) or that is unlikely that the environment would provide enough unless Designed (but again, Ewert et al don’t make this argument) or that it still leaves us with the question as to where the initial population of self-replicators came from (but that is not the question they pose, although it is the one that Kairosfocus poses).
In other words, the answer to the question: “can evolutionary processes, in principle result in populations of self-replicating organisms with complex adaptations that help them survive and breed in an environment of threats and resources?” the answer is yes. The question then becomes: is this how biological organism came to be? And we have lots of evidence that it is, at the least, a major contributory mechanism.
And incidentally, it tells us nothing about whether the universe was designed or not. Just as humans are capable of designing computer programs in which virtual populations evolve to be complex problem-solving algorithms, so could a Designer God design a universe in which such things evolved.
But the point I am making is that Ewert et al’s argument that Active Information is required for evolutionary processes to work is correct, but irrelevant to the question as to whether a Designer is involved. We do not need to invoke a Designer to account for the Active Information they say is required (and, on their definition, is).
Elizabeth:
Unguided evolution doesn’t have that. Unguided evolution cannot be modeled. That is why we are left with probabilities yet you can’t even demonstrate a feasibility.
Only a designer can account for active information. That is why one is invoked. If you ever find some evidence to the contrary please present it so we can all have a look.
I have not had time to read through the comments yet, so I apologize if I am repeating points already made. In any case, I wrote this before posting the article, but wanted to make sure everyone had their own say first. It’s not very systematic, but a list of points that I thought that Aurelio faulted upon:
1) the list of “crazy searches” is actually needed biologically, precisely because making true jumps in fitness requires surprising sets of mutations. Gregory Chaitin found this out in his modeling of evolution in Proving Darwin – every attempt using incremental search techniques landed him very quickly on, I forget the term, but minor peaks towards the beginning of the search, and not actually making any progress. For him to actually get novelty that wasn’t precoded, he had to introduce macromutations.
2) The article says, “the laws of physics will mandate that small changes in genotype will usually not cause huge changes in fitness.”. The problem is in the cases where recursivity is required. Here you run into the problem that Chaitin did – in order to hit the next peak, you need crazy macromutations, because the in-betweeners aren’t selectable.
3) English’s summary statement – “we see that Dembski, Ewert, and Marks’s argument does not show that Design is needed to have an evolutionary system that can improve fitness.” I think would be agreed to by all parties. The question is not whether improved fitness can happen, but how much and how far. That is where such reasoning falls down. That is why Dembski often uses 500 bits as the mark (it is based on the Universal Probability Bound). It’s not that *any* evolution needs to be shown, but rather 500 bits of evolution is shown (I would personally be happy with, say, 100 bits).
4) One of the article’s main points is whether or not evolution is actually a search, on the basis that evolution is passive, not active. However, this has several issues:
(a) the article conflate “search” with “optimal solution search”, or at least you appear to. An optimal solution search is not required for the formalism. It is often used because it is more recognizable and understandable both for the investigator and for the audience.
(b) even if organisms are passive, it doesn’t make it not a search from the mathematical formalism. Now, if the author thinks a better mathematical formalism would work, what is it? If there isn’t one, that seems bad for evolutionary theory as a scientific concept.
(c) As to organisms being passive in evolution, the evidence is that they aren’t. The idea of passive organisms is a leftover from a generation of biologists raised on Dawkins, which modern biologists are working hard to correct. See for instance Denis Noble’s speech to the American Physiological Society
So, in all, it seems that the search formalism works whether it is the environment or the organism acting, but recent biology shows that it is the organism acting. And, if one doesn’t like the formalism, *some* formalism needs to be specified in order to analyze the question mathematically. If it can’t be analyzed mathematically, why is it so highly regarded?
As for the biological relevance of Active Information, you all might be interested in an presentation I gave a while back. Here is the abstract and here is the poster. I have another unpublished paper giving a more general method, but it needs more work before publishing. I would be happy to share it with people who are interested, though.
Aurelio:
We have. OTOH your position has nothing beyond your misguided bloviations.
Box wrote:
This is incorrect. Or, at the very least, as a definition of materialism it leaves out most people who are normally described as such.
Under the view that there are no supernatural forces in the world, there is a huge difference between, say, a banana smoothie and a banana, even if all the banana smoothie contains is the banana that we were earlier considering. In other words, patterns matter, whether under materialism or anything else. There may be the exact same inventory of “chemicals” in the banana smoothie as there were in the banana, but no materialist would claim they are the same. This is because the banana has properties not possessed by the smoothie, and the smoothie has properties not possessed by the banana.
The interesting question is, of course, how do you make a smoothie into a banana without a Designer?
The “materialist” answer is, essentially, through evolutionary processes. Which do, indeed, require Active Information as defined by Ewert et al, but not necessarily a Mind.
Elizabeth- Materialists make all sorts of crazy claims but have not yet been able to support them. Materialism cannot explain bananas. Materialism cannot explain living organisms.
And your continued equivocation is duly noted. Why is it that you are totally incapable of understanding what is being debated? Is it your age or are you just insane?
johnnyb wrote:
Whether “true jumps” in fitness require “surprising sets of mutations” depends on the model. It is not necessarily the case. Indeed, if you watch an evolutionary model evolving a population, you regularly see lots of jumps, each followed by a long period of incremental fine tuning. They often don’t require a “surprising” (if by that you mean “improbable” set of mutations, and, interestingly, often the key change is initially quite disadvantageous, but not disastrously so. This is one of the reasons they are so powerful as design tools for human beings – they take directions that would be rejected by an “intelligent” designer.
You don’t if the fitness landscape is smooth, which is what AS means by invoking the laws of physics. Two things tend to make fitness landscapes in Nature smooth: one is that similar genotypes produce phenotypes with similar properties (i.e. offspring have similar features to their parents); and the other is that the environment itself is “smooth” – similar environments tend to be near each other in both space and time.
The question as to how far fitness can be improved is not limited by any number of bits. It is limited by the number of dimensions along which improvements can be made. That is a very generous limit.
Glad to see that UDers are finally cottoning on to Denis Noble! I advocated his ideas for years here but nobody took any notice. Yes, I agree that the “passive vs active” distinction is not helpful. What is important, though, when using the “search” method, is being careful to be clear who, or what, is doing the “searching”, and it is easy to be misled by careless anthropomorphising. The reason I think “search” is a poor metaphor for evolution is that there is no “searcher” and no “target”. It is, as Noble would almost certainly agree, a system we are talking about, from which emerges populations that are increasingly optimally fitted to survive and breed within the current environment, which itself is part of the system, and itself changing as a result of the evolving populations it accommodates. I think myself that it is as misleading to call the system a “search” for a “target” as it would be to call an ocean a “search” for a wave. There are no targets, there are simply constantly fluctuating local optima towards which populations are constantly tending.
Oh, I think it can be analyzed mathematically, but I don’t think search (or frequentist statistics) is the right math. Non-linear systems would be a better approach, I think, because that is what evolutionary systems are.
Will check out, thanks!
Jonathan Bartlett:
The post has been removed from the front page of UD. Is it going to appear in the UD archives, or is it going to be deleted? Please check with the site administrator.
Elizabeth:
So what? Merely improving fitness doesn’t help you.
However you are right in that unguided evolution is not a search and that is what makes it all the more impotent. Strange that you don’t realize that.
That is only your opinion. Seeing that genetic and evolutionary algorithms trace back to their designers, your point is way off the mark.
KF: “Further to this, within 24 hours of my having to process that very serious development in two venues, along you come waltzing in here to back up a post that obviously (by convenient topic) particularly targets me by focussing on themes I have been particularly associated with. And seemingly as if nothing serious is going on that has created a serious strain.”
KF, this speaks to exactly what I mentioned earlier. Elizabeth’s criticism of a theory that you happen to believe in is not a personal attack. I say this with all due respect, but your over the top reaction to her commenting here appears, from the outside, to be paranoid. Although, I have heard somewhere that when people are out to get you, paranoia is just good thinking. Maybe there is a history here that I am not aware of. But the only evidence that I have seen is Elizabeth commenting rationally and in good faith and you jumping all over her. If I may suggest, maybe the best approach is to take the Christian approach and forgive her for whatever grievances that you feel you have against her. I have found that the best defence against personal infringements is to openly forgive the person. If they have erred unintentionally, they often welcome the act. If their attacks were intentional, I have found that the act of forgiveness completely frustrates them
unwilling participant- If Liddle, et al., applied their criticisms and skepticism equally, you may have a point. If they ever show signs of understanding what is actually being debated, you would have a point. And if they could just step up and show how their position does it, so we could then compare, you would have a point.
Liddle, et al., bloviate and equivocate and that becomes intolerable rather quickly.
EL said:
Appeal to bare possibility.
Another appeal to bare possibility.
EL appeals, over and over, to bare possibility, while admitting there is no evidence to support the plausibility of such bare assertions:
Why the appeals to bare possibilities in lieu of any research into the scientific plausibility of such narratives? Ideological blinkers – the ideology comes first: materialism is true; given that, what then are the possibile explanations?
Joe: “unwilling participant- If Liddle, et al., applied their criticisms and skepticism equally, you may have a point. If they ever show signs of understanding what is actually being debated, you would have a point. And if they could just step up and show how their position does it, so we could then compare, you would have a point.
Liddle, et al., bloviate and equivocate and that becomes intolerable rather quickly.”
But do comments such as the following really add to the discussion:
If my memory serves me correct, the UD moderator threatened to ban someone for commenting on someone’s age.
To be honest, it is comments such as these that almost make me ashamed to admit that I am an ID supported. I know that we can all do better.
“Bare” possibility is an excellent start, William. In other words, often we start with a putative mechanism. If that mechanism is impossible, then we have to stop. But the evolutionary system is not only possible, we know that we can use it, for our own purposes, to find solutions to problems that are beyond mere human design capacity to solve.
So the system does indeed work to produce complex adapted entities.
But of course that isn’t where Darwin started – he started from observation, and came up with that mechanism to explain his observations.
And hypotheses based on it have been tested many times – in the field and in the lab. We now now far more than Darwin did not only about the mechanisms of variance generation and of heritability, but also of the mathematics of population genetics. So we understand now, as Darwin did not, the role of drift, for instance, which is an important feature of computer evolutionary systems as well.
Now, you can still argue that it might not be right – there may be some other factor in addition to all this, and you might be correct. But the argument that such mechanisms CANNOT account for the evolution of complex adaptive organisms is refuted. Dembski et al concede this in the very papers cited – the very concept of Active Information is their formulation for How The Milk Got Into The Coconut – their quantification of the information that must be present for evolutionary processes to result in adaptive evolution.
If it didn’t actually work, then Active Information would always be zero.
unwilling participant:
They illustrate the problem. Have you posted anything that added to any discussion?
LoL! People like you are part of the problem.
You need to ask “why is Joe posting that?” and not just think I say it just because.
Give me an honest opponent who actually addresses the issues and I won’t be saying things like that.
Is this supposed to address the problem of preservation of homeostasis which I argued in #155?
UP, pardon, with all due respect I am not speaking to EL’s criticisms as such or even her rhetorical pattern of drumbeat repetition of the long since cogently corrected as though such will beat down the problems with it; those, even if it is a bear to have to repeat yet again for the onlooker, are relatively easy to correct — cf 138 supra for example, though that effort forced me to use time that could more profitably been spent on other things. I am speaking here to her editorial role at TSZ and serving as enabling front for radical agit-prop activists and stalkers of a sort I do not want to further detail on here. In that context, I am looking at the known one two punch tactic and the timing of her resurfacing here at UD in a particular context. I was just hit with stalking and outing tactics locally, an assault that still continues through characters associated with site A and sometimes site T (and likely involving on the ground efforts), as well as further sites that are yet more extreme. Then, from T right after, there is a follow up that targets a theme that I am a main person to deal with here at site U. Under these particular circumstances, no I cannot afford the luxury of not drawing connecting dots. That may well seem a strange thing to you [I assume you have little experience with ruthless or outright nihilistic agit-prop activists], but that sort of pattern is unfortunately all too familiar from the ruthless politics playbook: the one-two politics of personal destruction punch designed to discredit a target and try to take away its position of strength. Familiar, going back all the way to the days when I had to deal with Moscow and Havana trained professional agitators on my Uni Campus. And, back on the “criticisms” front, I assure you, the talking points above that have been corrected yet again will be presented in all sorts of venues again and again as though they were decisive, years from now. Never mind that it is already obvious that the objectors to design have no proper answer to my corrective remarks at 138 etc, as well as much further up. In fact, that repetition out of context to frame a target was a part of the tactics used locally, to try to use EL and others as a face and front to pretend that my critique several years ago, of Aiden’s vampire clergyman evidently promoting inter alia genocide video was an example of how crazy or worse I am. And, a lot of other things are being snipped out of context, twisted into falsehood and used in accusations that are torts. KF
Elizabeth:
And now we know his mechanism is incapable of producing what we observe unless we started out with a great deal of biological diversity including metazoans and all existing families (Linnean).
By what? Your bald declarations are meaningless, Lizzie. Where is your model?
Jonathan Bartlett:
You’ve said nothing about active information, except to cite yourself. In an attempt to channel your interest in Chaitin, I’ll ask if you have read Ewert, Dembski, and Marks, “Active Information in Metabiology.” Do you know what they actually measure?
The reason that Chaitin uses the term metabiology is that he does not model biological evolution. Everything he has done has been constrained by his capacity to prove theorems. He makes that very clear. What he has managed to prove does not indicate what “is actually needed biologically.”
Chaitin proves results on evolution of Turing machines, ignoring computability and resource requirements. You can’t justify using his results to make claims about real-world physics and genetics. Don’t listen to me. Listen to him.
Now you’re referring to specified complexity, not active information. It is easy to show how the two are related. The result is not pleasant for ID proponents. If I drop it into this thread, will the post vanish? By the way, Dembski increased his universal probability bound to 2^-400 in 2005. Why does your happiness with a fixed bound matter? The logic of a fixed bound has always been criticized. Ewert, Dembski, and Marks have dispensed with it entirely in their applications of algorithmic specified complexity.
I’ve cut you off because talk about biological evolution being a “search” in the sense of DEM goes nowhere. Biological evolution does not terminate and say, “It’s this one.” Some models do that. Famously, “The map is not the territory.”
Joe, Pardon, I think you have gone too far, slipped off the wagon. Please, get back up on it. KF
KF,
I think UP’s ignorance is feigned, and his insertion into the issues between you and EL calculated to incite.
Box: my comment was to alert you to a statement you made that is not true.
KF, assuming that the conspiracy you are talking about is true, which I highly doubt, your reaction to it just plays right into their hands. I encourage you to dispassionately read EL’s comments and your responses to them. To an outsider, your comments appear as paranoid rants, not reasoned debate.
I only say this because I honestly think that your behaviour in response to EL in this thread goes more to discrediting ID than anything EL has said. And I know that this is not your intent.
EL @ 162:
The issue is not about patterns. The issue is about actualities and potentialities (or act and potency if you prefer). On both materialist premises and theistic premises, the chemicals that compose a banana have inherent potentiality to become first a banana and then a smoothie. On materialist premises the chemicals in a human body have no potentiality to become self-aware; indeed the concept of self-aware chemicals is meaningless. It follows that materialists must deny or otherwise explain away patently obvious and undeniable facts. Indeed, the very act of denial is an act of intentionality that is impossible on materialist premises. And that is why materialism is incoherent and does not even have the potential of ever being otherwise.
Barry Arrington: On materialist premises the chemicals in a human body have no potentiality to become self-aware
Sure it can. The brain has memory, the memory can be used to draw forth internal images to form models, and these models can include a model of oneself.
EL said:
No, it’s not. It’s a start, but not a particularly excellent one. An excellent start would be a hypothesis that begins with a model that is already known to be scientifically plausible in accounting for the effects/phenomena observed.
However, I agree that under the ideological constraints of materialism, “bare possibility” is enough to be considered by such materialists as “an excellent start”, given their need to avoid what may be more plausible starts.
Given that the evolutionary algorithms you are apparently referring to are actually designed by humans to solve problems in the first place, those solutions are not beyond human design capacity to solve.
You are apparently equivocating between human-designed EA’s and biologically instantiated EA’s assumed to be undirected by intelligence.
Entirely untrue; Darwin started with ideology, and then came up with a bare possibility that served that ideology, in the face of evidence he himself considered currently contradictory to that ideological commitment (current state of fossils, the human eye), using as supporting evidence that which directly contradicted his hypothesis (artificial selection and breeding).
As you yourself admit, the core hypothesis – that evolution is unguided by intelligence – has never been tested or verified beyond “mere possibility”. Increasingly detailed decriptions of the actual processes involved, and more detailed examination of what is going on, has not moved that core hypothesis forward into plausibility one iota – indeed, what we have discovered has if anything moved that assumption further and further from anything remotely resembling “scientific plausibility”.
The argument has always been not that it is physically impossible, but rather that it is scientifically implausible. If all you have is speculative, bare possibility, then you have offered no argument or hypothesis worth responding to.
As Joe repeatedly points out: you have nothing.
It’s a trivial “concession” that something is a bare possibility.
I can’t see how this is anything other than the same equivocation pointed out above
EL says,
What we can do is demonstrate, mathematically in this case, that certain classes of mechanism can account for certain outputs.
I say,
Agreed, and what IIT has established is that algorithms (like evolution) can not produce the kind of information that Dembski et al are calling a “Target”.
This is not even a debate at this point it is settled mathematics.
The only recourse critics have is to assert that conformance to targets is not how design works or that the targets in question are not integrated information Predictability that is just the tact you are taking.
We have seen the same thing with materialists claiming that the information integration we associate with consciousness in not non-lossy thus denying unitary consciousness.
I expect that that is the way that the debate will play-out in the future as these concepts filer down.
EL says,
And we can demonstrate readily, by means of computer simulations, that, starting from a population of self-replicators in an environment containing both resources and threats, that that population will adapt – including acquiring quite complex features
I say,
Again this is completely beside the point scissors can produce all kinds of shapes even complex ones but they can’t explain any of them.
cutting paper and keeping all shapes that don’t blow away in the wind will not produce a circle any more than any old random search will.
peace
Barry Arrington wrote:
I think Dembski would disagree, Barry, and it is Dembski’s work we are discussing in this thread. His body of work in ID has been to find the signature of patterns that indicate design. But I am happy to substitute the word “configuration” which he also uses, and which is Kairosfocus’s preferred term. Or, better still, system.
And that is my point, really. Chemicals are not self-aware, nor are neurons. What a materialist regards as self-aware is not the chemicals, or the neurons, that make up a human organism, but the system of which they form parts. A system can have properties not possessed by its parts, just as parts can have properties not possessed by the system. It is indeed meaningless to say that a chemical is self-aware – I would even say it is meaningless to say that a brain is self-aware. But an awake person is.
Well, I disagree. That, or I am not a materialist by your criteria! I do not think that chemicals are self-aware, but I think that the configuration of chemicals that form a human being is. Or configuration of fundamental particles, for that matter. The point being that it is not the units that a person is configured out of that possess the property of self-awareness but the configuration itself, just as the banana has properties that are not possessed by the bits of mushed banana in your smoothie!
To get back to Dembski et al: the interesting question (it seems to me) is: by what mechanism can unconfigured matter (or very uninterestingly configured matter) become a living thing? We know it can, because it happens in our own bodies – what we eat (including banana smoothies!) becomes what we are, and even becomes someone else, in the case of a woman. Materialists do not deny this! The question is whether it requires some miraculous intervention, or whether the properties required are intrinsic to the universe itself.
SL;
Pardon but 500 bits works very well as a reasonable threshold as outlined at 138 above regarding needle in haystack searches for islands of function. On sol system scope.
For observed cosmos, I point to 1,000 bits, its square.
The atomic interaction scope set of events for 10^80 atoms at 10^13 or 14 events/s for 10^17 s is 10^110 – 111, which then compares with 3.27*10^301 possibilities. Setting the former to 1 straw, the comparable haystack for 1,000 bits would dwarf our observed cosmos.
Searches of that scope, if blind will only reliably capture the bulk, not deeply isolated zones T, where W – T = B. Thus, hoped for golden searches that cut W down to much smaller scopes, face the issue also pointed out much further above. Namely, a search is a subset, so blind searches are sampling the set of subsets of scope 2^W. Exponentially harder.
S4S — search for [a golden] search — is worse than direct blind search.
So also, on avg we have no reason to expect a blind search to outperform a classic flat random sample taken as a yardstick. Which in the context in view is hopeless.
Joe’s repeated point about lacking a viable mechanism is well made.
Now, a case presents itself as being a blindly picked golden search, that bang, puts you down Johnny on the spot so a light dusting of further incremental search gets you into hill-climbing ratchets or their kissing cousins. Evolutionary Algorithms, etc, just to call a name.
The outlined analysis will show why one is justified to use the yardstick search and its expected outcome, feed in the golden search conundrum result and infer the externally, intelligently injected active info that has made the restricted search feasible.
And no, dismissive rhetoric about “big numbers” is not an answer to this.
Where, of course, all of this shows how information issues and linked search, statistical thermodynamics foundations, likelihood etc are all facets of an overall problem that has not been adequately faced and cogently addressed then resolved by the evolutionary materialist establishment in our time.
And, you will notice, I am not associating you with the gamesmanship problem that so taints this thread otherwise.
KF
EL says,
I do not think that chemicals are self-aware, but I think that the configuration of chemicals that form a human being is.
I say,
If you are going to make this assumption you owe us an explanation how such a thing is even possible given materialism.
peace
fifthmonarchyman: what IIT has established is that algorithms (like like evolution) can not produce the kind of information that Dembski et al are calling a “Target”.
What? Can you state that more precisely?
David Deutsch, who pioneered the field of quantum computing, is developing a new, deeper theory, called Constructor Theory, to bring in a number of significant fields into fundamental physics.
This includes information….
Constructor Theory of Information
… and evolution.
Constructor Theory of Life
The key point is, Constructor Theory provides a means to express explanations at the most fundamental level in physics while, at the same time, not being being reductionist in nature.
fifthmonarchyman says:
Then we are misunderstanding each other. Evolution, considered as a system, can indeed produce the kind of information that Dembski et al are calling a Target, but, as they argue, by virtue of Active Information embedded in the fitness function. My understanding of their argument is that yes, evolutionary processes can find a Target better than Blind Search, but only by virtue of Active Information that is pre-existing in the system – Dembski used to call it “smuggled in”. My point is that yes, his “Active Information” is indeed required, but no smuggling is necessary. In a computer environment, clearly it is specified by a human designer (as, for that matter, are initial set of virtual organisms and their repertoire of variation). But these features have direct counterparts in the natural world, namely the environment, and the population of organisms (or proto-organisms) respectively.
I’m not following you, I’m afraid. I am not making either of the arguments you are ascribing to me.
I don’t see the relevance of scissors to my point.
BA, you raise a whole can of worms there, one that has been a subject of major discussion recently at UD with the materialism advocates unable to adequately respond. I think Reppert has captured the issue very well:
Onlookers, observe carefully to see how this is handled or as is predictable, not handled properly by materialism advocates and fellow travellers. KF
ZAc say,
What? Can you state that more precisely?
I say,
I could if you were interested in actual dialog here but as you have repeatedly demonstrated you are not. So I see no reason too.
I’ll give you a hint just for kicks it has to do with nonlossy data compression.
peace
fifthmonarchyman says:
I don’t know that it is. I am simply pointing out that materialism does not deny that wholes have properties quite different from those of their parts – that a banana is not the same as a bag of banana mush, nor a tree the same as a pile of sawdust. Bananas and trees require explanations even though we ascribe consciousness to neither, and a materialist explanation does not require that they are equal to undifferentiated configurations of their parts.
I am more than happy to discuss consciousness with you, but it is not the topic of this thread.
fifthmonarchyman: If you are going to make this assumption you owe us an explanation how such a thing is even possible given materialism.
The burden of proof is on those who claim that materialism is incoherent. At this point, there is no complete scientific model of consciousness. Perhaps materialism, per se, will be disproven at some point. However, it is just as consistent with the scientific evidence as most other metaphysics.
In Being as Communion, Dembski indicates that intelligent design is:
But this is odd, because he devotes the last three chapters to active information, which does not involve patterns. The “target” event can be any small subset of the search space. For a fixed description language, almost all targets have no more concise description than a listing of the elements, which is to say that the elements follow no pattern.
Popperian:
No law of nature ever yet did anything,as it is a mental construct that is fundamentally descriptive not an active causal factor in its own right.
Specifying classes of physical transformation that are credibly possible per empirical investigation is one thing, but again, physical transformation presumes something is there to be transformed thus changed in accord with definite processes. That is what the dynamical view is about.
Making the stuff and the forces and inertial resistances etc implicit does not change the fact that you need to have an IS to ground a becoming, and what be-com[e]-ings are warranted as possible. Physical laws BTW are not based on logical necessity.
KF
fifthmonarchyman: I could …
But won’t.
fifthmonarchyman: I’ll give you a hint just for kicks it has to do with nonlossy data compression.
That’s not precise, but vague.
fifthmonarchyman: what IIT has established is that algorithms (like like evolution) can not produce the kind of information that Dembski et al are calling a “Target”.
Do you mean a mathematical proof? If so, it’s presumably written down somewhere.
Zachriel,
that burden has been met any number of times in any number of ways as has been just discussed here at UD to exhaustion. Wishing away the balance of those discussions does not change their force.
Let me just excerpt a 101:
_______________
>> 8 –> But as Liebnitz pointed out in his famous analogy of the Mill, the parts of a machine interact through blind mechanical interactions (including chance disturbances etc), and so have no inherent rationality, imagination, intent or obligation. That is, there is an inescapable gap between the physical “is” and the logical inference, the mental “vision,” the decision or the force of “ought,” much less self-awareness. Citing from his The Monadology, 17:
It must be confessed, however, that perception, and that which depends upon it, are inexplicable by mechanical causes, that is to say, by figures and motions. Supposing that there were a machine whose structure produced thought, sensation, and perception, we could conceive of it as increased in size with the same proportions until one was able to enter into its interior, as he would into a mill. Now, on going into it he would find only pieces working upon one another, but never would he find anything to explain perception [[i.e. abstract conception]. It is accordingly in the simple substance, and not in the compound nor in a machine that the perception is to be sought . . .
9 –> By contrast, mind-body dualists such as Liebnitz, are often dismissively said to be proposing an unobservable “ghost in the machine,” for which there is said to be no reason to see how it can interact with the brain-body closed loop system.
10 –> However, if the proposed immaterial mind acts the part of a supervisory controller in the Smith cybernetic loop, it may act informationally (and so also conceptually) on the “bio-robot” of the brain-body cybernetic system. Thus, the logical or imaginative, creative process can intervene in the brain-body cybernetic system informationally, conceptually and logically, not by mere mechanical cause-effect chains.
11 –> In other words: Liebnitz’s wheels simply grind the one against the other in a causal chain; by themselves, they do not originate their organisation nor do they logically infer consequences of premises, etc.
12 –> Some materialists then suggest that consciousness is an “emergent” property of matter in the brain in action; one dependent on that matter for its existence and behaviour. But, “emergence” is itself immediately problematic: is “emergence” a euphemism for “Voila: poof!” . . . i.e “magic”?
13 –> Some materialists go further and suggest that mind is more or less a delusion. For instance, Sir Francis Crick is on record, in his 1994 The Astonishing Hypothesis:
. . . that “You”, your joys and your sorrows, your memories and your ambitions, your sense of personal identity and free will, are in fact no more than the behaviour of a vast assembly of nerve cells and their associated molecules. As Lewis Carroll’s Alice might have phrased: “You’re nothing but a pack of neurons.” This hypothesis is so alien to the ideas of most people today that it can truly be called astonishing.
14 –> Philip Johnson has replied that Sir Francis should have therefore been willing to preface his works thusly: “I, Francis Crick, my opinions and my science, and even the thoughts expressed in this book, consist of nothing more than the behavior of a vast assembly of nerve cells and their associated molecules.” Johnson then acidly commented: “[[t]he plausibility of materialistic determinism requires that an implicit exception be made for the theorist.” [[Reason in the Balance, 1995.]
15 –> In short, it is at least arguable that self-referential absurdity is the dagger pointing to the heart of evolutionary materialistic models of mind and its origin. An audio clip by William Lane Craig that summarises Plantinga’s argument on this in a nutshell, is useful:
. . . This issue can be addressed at a more sophisticated level [[cf. Hasker in The Emergent Self (Cornell University Press, 2001), from p 64 on, e.g. here as well as Reppert here and Plantinga here (briefer) & here (noting updates in the 2011 book, The Nature of Nature)], but without losing its general force, it can also be drawn out a bit in a fairly simple way:
a: Evolutionary materialism argues that the cosmos is the product of chance interactions of matter and energy, within the constraint of the laws of nature; from hydrogen to humans by undirected chance and necessity.
b: Therefore, all phenomena in the universe, without residue, are determined by the working of purposeless laws of chance and/or mechanical necessity acting on material objects, under the direct or indirect control of happenstance initial circumstances.
(This is physicalism. This view covers both the forms where (a) the mind and the brain are seen as one and the same thing, and those where (b) somehow mind emerges from and/or “supervenes” on brain, perhaps as a result of sophisticated and complex software looping. The key point, though is as already noted: physical causal closure — the phenomena that play out across time, without residue, are in principle deducible or at least explainable up to various random statistical distributions and/or mechanical laws, from prior physical states. Such physical causal closure, clearly, implicitly discounts or even dismisses the causal effect of concept formation and reasoning then responsibly deciding, in favour of specifically physical interactions in the brain-body control loop; indeed, some mock the idea of — in their view — an “obviously” imaginary “ghost” in the meat-machine. [[There is also some evidence from simulation exercises, that accuracy of even sensory perceptions may lose out to utilitarian but inaccurate ones in an evolutionary competition. "It works" does not warrant the inference to "it is true."] )
c: But human thought, clearly a phenomenon in the universe, must now fit into this meat-machine picture. So, we rapidly arrive at Crick’s claim in his The Astonishing Hypothesis (1994): what we subjectively experience as “thoughts,” “reasoning” and “conclusions” can only be understood materialistically as the unintended by-products of the blind natural forces which cause and control the electro-chemical events going on in neural networks in our brains that (as the Smith Model illustrates) serve as cybernetic controllers for our bodies.
d: These underlying driving forces are viewed as being ultimately physical, but are taken to be partly mediated through a complex pattern of genetic inheritance shaped by forces of selection [["nature"] and psycho-social conditioning [["nurture"], within the framework of human culture [[i.e. socio-cultural conditioning and resulting/associated relativism]. And, remember, the focal issue to such minds — notice, this is a conceptual analysis made and believed by the materialists! — is the physical causal chains in a control loop, not the internalised “mouth-noises” that may somehow sit on them and come along for the ride.
(Save, insofar as such “mouth noises” somehow associate with or become embedded as physically instantiated signals or maybe codes in such a loop. [[How signals, languages and codes originate and function in systems in our observation of such origin -- i.e by design -- tends to be pushed to the back-burner and conveniently forgotten. So does the point that a signal or code takes its significance precisely from being an intelligently focused on, observed or chosen and significant alternative from a range of possibilities that then can guide decisive action.])
e: For instance, Marxists commonly derided opponents for their “bourgeois class conditioning” — but what of the effect of their own class origins? Freudians frequently dismissed qualms about their loosening of moral restraints by alluding to the impact of strict potty training on their “up-tight” critics — but doesn’t this cut both ways? Should we not ask a Behaviourist whether s/he is little more than yet another operantly conditioned rat trapped in the cosmic maze? And — as we saw above — would the writings of a Crick be any more than the firing of neurons in networks in his own brain?
f: For further instance, we may take the favourite whipping-boy of materialists: religion. Notoriously, they often hold that belief in God is not merely cognitive, conceptual error, but delusion. Borderline lunacy, in short. But, if such a patent “delusion” is so utterly widespread, even among the highly educated, then it “must” — by the principles of evolution — somehow be adaptive to survival, whether in nature or in society. And so, this would be a major illustration of the unreliability of our conceptual reasoning ability, on the assumption of evolutionary materialism.
g: Turning the materialist dismissal of theism around, evolutionary materialism itself would be in the same leaky boat. For, the sauce for the goose is notoriously just as good a sauce for the gander, too.
h: That is, on its own premises [[and following Dawkins in A Devil's Chaplain, 2004, p. 46], the cause of the belief system of evolutionary materialism, “must” also be reducible to forces of blind chance and mechanical necessity that are sufficiently adaptive to spread this “meme” in populations of jumped- up apes from the savannahs of East Africa scrambling for survival in a Malthusian world of struggle for existence. Reppert brings the underlying point sharply home, in commenting on the “internalised mouth-noise signals riding on the physical cause-effect chain in a cybernetic loop” view:
. . . let us suppose that brain state A, which is token identical to the thought that all men are mortal, and brain state B, which is token identical to the thought that Socrates is a man, together cause the belief that Socrates is mortal. It isn’t enough for rational inference that these events be those beliefs, it is also necessary that the causal transaction be in virtue of the content of those thoughts . . . [[But] if naturalism is true, then the propositional content is irrelevant to the causal transaction that produces the conclusion, and [[so] we do not have a case of rational inference. In rational inference, as Lewis puts it, one thought causes another thought not by being, but by being seen to be, the ground for it. But causal transactions in the brain occur in virtue of the brain’s being in a particular type of state that is relevant to physical causal transactions. [[Emphases added. Also cf. Reppert's summary of Barefoot's argument here.]
i: The famous geneticist and evolutionary biologist (as well as Socialist) J. B. S. Haldane made much the same point in a famous 1932 remark:
“It seems to me immensely unlikely that mind is a mere by-product of matter. For if my mental processes are determined wholly by the motions of atoms in my brain I have no reason to suppose that my beliefs are true. They may be sound chemically, but that does not make them sound logically. And hence I have no reason for supposing my brain to be composed of atoms. In order to escape from this necessity of sawing away the branch on which I am sitting, so to speak, I am compelled to believe that mind is not wholly conditioned by matter.” [["When I am dead," in Possible Worlds: And Other Essays [1927], Chatto and Windus: London, 1932, reprint, p.209. (Highlight and emphases added.)]
. . . DI Fellow, Nancey Pearcey brings this right up to date (HT: ENV) in a current book, Finding Truth:
A major way to test a philosophy or worldview is to ask: Is it logically consistent? Internal contradictions are fatal to any worldview because contradictory statements are necessarily false. “This circle is square” is contradictory, so it has to be false. An especially damaging form of contradiction is self-referential absurdity — which means a theory sets up a definition of truth that it itself fails to meet. Therefore it refutes itself . . . .
An example of self-referential absurdity is a theory called evolutionary epistemology, a naturalistic approach that applies evolution to the process of knowing. The theory proposes that the human mind is a product of natural selection. The implication is that the ideas in our minds were selected for their survival value, not for their truth-value.
But what if we apply that theory to itself? Then it, too, was selected for survival, not truth — which discredits its own claim to truth. Evolutionary epistemology commits suicide.
Astonishingly, many prominent thinkers have embraced the theory without detecting the logical contradiction. Philosopher John Gray writes, “If Darwin’s theory of natural selection is true,… the human mind serves evolutionary success, not truth.” What is the contradiction in that statement?
Gray has essentially said, if Darwin’s theory is true, then it “serves evolutionary success, not truth.” In other words, if Darwin’s theory is true, then it is not true.
Self-referential absurdity is akin to the well-known liar’s paradox: “This statement is a lie.” If the statement is true, then (as it says) it is not true, but a lie.
Another example comes from Francis Crick. In The Astonishing Hypothesis, he writes, “Our highly developed brains, after all, were not evolved under the pressure of discovering scientific truths but only to enable us to be clever enough to survive.” But that means Crick’s own theory is not a “scientific truth.” Applied to itself, the theory commits suicide.
Of course, the sheer pressure to survive is likely to produce some correct ideas. A zebra that thinks lions are friendly will not live long. But false ideas may be useful for survival. Evolutionists admit as much: Eric Baum says, “Sometimes you are more likely to survive and propagate if you believe a falsehood than if you believe the truth.” Steven Pinker writes, “Our brains were shaped for fitness, not for truth. Sometimes the truth is adaptive, but sometimes it is not.” The upshot is that survival is no guarantee of truth. If survival is the only standard, we can never know which ideas are true and which are adaptive but false.
To make the dilemma even more puzzling, evolutionists tell us that natural selection has produced all sorts of false concepts in the human mind. Many evolutionary materialists maintain that free will is an illusion, consciousness is an illusion, even our sense of self is an illusion — and that all these false ideas were selected for their survival value.
So how can we know whether the theory of evolution itself is one of those false ideas? The theory undercuts itself.
A few thinkers, to their credit, recognize the problem. Literary critic Leon Wieseltier writes, “If reason is a product of natural selection, then how much confidence can we have in a rational argument for natural selection? … Evolutionary biology cannot invoke the power of reason even as it destroys it.”
On a similar note, philosopher Thomas Nagel asks, “Is the [evolutionary] hypothesis really compatible with the continued confidence in reason as a source of knowledge?” His answer is no: “I have to be able to believe … that I follow the rules of logic because they are correct — not merely because I am biologically programmed to do so.” Hence, “insofar as the evolutionary hypothesis itself depends on reason, it would be self-undermining.”
. . . also tellingly highlighting Darwin’s selective skepticism:
People are sometimes under the impression that Darwin himself recognized the problem. They typically cite Darwin’s famous “horrid doubt” passage where he questions whether the human mind can be trustworthy if it is a product of evolution: “With me, the horrid doubt always arises whether the convictions of man’s mind, which has been developed from the mind of the lower animals, are of any value or at all trustworthy.”
But, of course, Darwin’s theory itself was a “conviction of man’s mind.” So why should it be “at all trustworthy”?
Surprisingly, however, Darwin never confronted this internal contradiction in this theory. Why not? Because he expressed his “horrid doubt” selectively — only when considering the case for a Creator.
From time to time, Darwin admitted that he still found the idea of God persuasive. He once confessed his “inward conviction … that the Universe is not the result of chance.” It was in the next sentence that he expressed his “horrid doubt.” So the “conviction” he mistrusted was his lingering conviction that the universe is not the result of chance.
In another passage Darwin admitted, “I feel compelled to look to a First Cause having an intelligent mind in some degree analogous to that of man.” Again, however, he immediately veered off into skepticism: “But then arises the doubt — can the mind of man, which has, as I fully believe, been developed from a mind as low as that possessed by the lowest animal, be trusted when it draws such grand conclusions?”
That is, can it be trusted when it draws “grand conclusions” about a First Cause? Perhaps the concept of God is merely an instinct programmed into us by natural selection, Darwin added, like a monkey’s “instinctive fear and hatred of a snake.”
In short, it was on occasions when Darwin’s mind led him to a theistic conclusion that he dismissed the mind as untrustworthy. He failed to recognize that, to be logically consistent, he needed to apply the same skepticism to his own theory . . . .
Applied consistently, Darwinism undercuts not only itself but also the entire scientific enterprise. Kenan Malik, a writer trained in neurobiology, writes, “If our cognitive capacities were simply evolved dispositions, there would be no way of knowing which of these capacities lead to true beliefs and which to false ones.” Thus “to view humans as little more than sophisticated animals …undermines confidence in the scientific method.”
Just so. Science itself is at stake. John Lennox, professor of mathematics at the University of Oxford, writes that according to atheism, “the mind that does science … is the end product of a mindless unguided process. Now, if you knew your computer was the product of a mindless unguided process, you wouldn’t trust it. So, to me atheism undermines the rationality I need to do science.”
Of course, the atheist pursuing his research has no choice but to rely on rationality, just as everyone else does. The point is that he has no philosophical basis for doing so. Only those who affirm a rational Creator have a basis for trusting human rationality.
The reason so few atheists and materialists seem to recognize the problem is that, like Darwin, they apply their skepticism selectively . . .
j: Therefore, though materialists will often try to pointedly ignore or angrily brush aside the issue, we may freely argue: if such evolutionary materialism is true, then (i) our consciousness, (ii) the “thoughts” we have, (iii) the conceptualised beliefs we hold, (iv) the reasonings we attempt based on such and (v) the “conclusions” and “choices” (a.k.a. “decisions”) we reach — without residue — must be produced and controlled by blind forces of chance happenstance and mechanical necessity that are irrelevant to “mere” ill-defined abstractions such as: purpose or truth, or even logical validity.
(NB: The conclusions of such “arguments” may still happen to be true, by astonishingly lucky coincidence — but we have no rational grounds for relying on the “reasoning” that has led us to feel that we have “proved” or “warranted” them. It seems that rationality itself has thus been undermined fatally on evolutionary materialistic premises. Including that of Crick et al. Through, self-reference leading to incoherence and utter inability to provide a cogent explanation of our commonplace, first-person experience of reasoning and rational warrant for beliefs, conclusions and chosen paths of action. Reduction to absurdity and explanatory failure in short.)
k: And, if materialists then object: “But, we can always apply scientific tests, through observation, experiment and measurement,” then we must immediately note that — as the fate of Newtonian Dynamics between 1880 and 1930 shows — empirical support is not equivalent to establishing the truth of a scientific theory. For, at any time, one newly discovered countering fact can in principle overturn the hitherto most reliable of theories. (And as well, we must not lose sight of this: in science, one is relying on the legitimacy of the reasoning process to make the case that scientific evidence provides reasonable albeit provisional warrant for one’s beliefs etc. Scientific reasoning is not independent of reasoning.)
l: Worse, in the case of origins science theories, we simply were not there to directly observe the facts of the remote past, so origins sciences are even more strongly controlled by assumptions and inferences than are operational scientific theories. So, we contrast the way that direct observations of falling apples and orbiting planets allow us to test our theories of gravity.
m: Moreover, as Harvard biologist Richard Lewontin reminds us all in his infamous January 29, 1997 New York Review of Books article, “Billions and billions of demons,” it is now notorious that:
. . . It is not that the methods and institutions of science somehow compel [[materialistic scientists] to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in the door. [[And if you have been led to imagine that the immediately following words justify the above, kindly cf. the more complete clip and notes here.]
n: Such a priori assumptions of materialism are patently question-begging, mind-closing and fallacious.
o: More important, to demonstrate that empirical tests provide empirical support to the materialists’ theories would require the use of the very process of reasoning and inference which they have discredited.
p: Thus, evolutionary materialism arguably reduces reason itself to the status of illusion. But, as we have seen: immediately, that must include “Materialism.”
q: In the end, it is thus quite hard to escape the conclusion that materialism is based on self-defeating, question-begging logic.
r: So, while materialists — just like the rest of us — in practice routinely rely on the credibility of reasoning and despite all the confidence they may project, they at best struggle to warrant such a tacitly accepted credibility of mind and of concepts and reasoned out conclusions relative to the core claims of their worldview. (And, sadly: too often, they tend to pointedly ignore or rhetorically brush aside the issue.) >>
_______________
There is much more just scroll back over the past month or two here at UD.
Burden met.
KF
kairosfocus:
When I remark on Dembski, I am not remarking on you.
I’d just like to point out an assymmetry here: Most biologists do not argue that evolution proves materialism. The argument for evolution as a mechanism that accounts for well-adapted organisms is not an argument for materialism.
On the other hand, the argument that biology indicates Design is an argument against materialism – it is a specific argument for a Designer.
Therefore the burden of demonstration is not on biologists to demonstrate that evolutionary processes are sufficient to account for the phenomena of life. They probably aren’t, or at least, there are almost certainly many many mechanisms that we don’t yet know about that are of key importance. One unsolved issue is the Origin of Life itself; another is whether or not mutations are truly orthogonal to fitness – they may not be. It may be that certain mutations are more likely under circumstances in which they are likely to be beneficial. In which case that would be interesting. It would not disprove materialism, nor would finding an explanatory mechanisms to account for such a finding prove it again.
Evolutionary theory is no threat to a non-materialist view. What is at issue here is whether the Ewert, Dembski and Marks concept of Active Information validates a Design Inference. I don’t think it does, because I don’t think the Active Information they define implies a designer.
It would be worth discussing, as it is the topic of the thread!
EL says,
My understanding of their argument is that yes, evolutionary processes can find a Target better than Blind Search, but only by virtue of Active Information that is pre-existing in the system – Dembski used to call it “smuggled in”.
I say,
Evolution is merely a tool and a deficient tool at that. By itself evolution is incapable of reaching a target.
Saying evolution can find a target with the addition of active information is like saying I could pass the Bar examination if I had the all the answers. True but vacuous
You say,
I don’t see the relevance of scissors to my point.
I say,
A tool is a tool is a tool and tools are only as good as the hands that guide them.
peace
fifthmonarchyman, can I ask you what you mean by the word “evolution” in the sentence “By itself, evolution is incapable of reaching a target” How are you defining “evolution” in that sentence? Because if it is something like “self-replication with heritable variation in reproductive success in the current environment” – yes, it is capable of reaching a “target”.
But perhaps you are referring only to the “self-replication with heritable variation” part? If so, you are correct. Unless that variation includes variation in reproductive success in the current environment, then there is no reason to think that the population will reach some “target” level of adaptation. It needs information from the environment in the form of factors that result in differential reproduction.
That is what Ewert et al are calling Active Information, and I agree it is necessary. However WITH that information (which is intrinsic to Darwin’s actual theory), then yes, evolution can reach a target.
EL, you are of course predictably — it has happened over and over — ignoring something like Lewontin’s outright admission in NYRB, Jan 1997. As is pointed out above. This simply underscores the longstanding pattern, and implies the relevance of other concerns now that there are strong indications that it is not just cyber stalking anymore, it is highly likely on the ground. I need not elaborate on what hostile stalking implies, and on what enabling behaviour that provides cover entails. KF
EL says,
Most biologists do not argue that evolution proves materialism. The argument for evolution as a mechanism that accounts for well-adapted organisms is not an argument for materialism.
On the other hand, the argument that biology indicates Design is an argument against materialism – it is a specific argument for a Designer.
I say,
Repeat after me slowly.
ID is not ANTI EVOLUTION. It is an argument against materialism only. As such Biologists should have no problem with ID.
ID does not argue that evolution is incapable of producing well-adapted organisms.
Please try and refrain from attacking a straw man.
peace
SL, In material part, I commented at 184 for the benefit of the 99% of 50,000 visitors to UD per month who never comment. They, too have an interest in seeing the other side of the story. KF
Waitress: Good morning. May I take your order?
Joe:I fancy a burger today. What dressing does it come with?
Waitress:It comes with ketchup by default, but you can order cheese, mayo, thousand island, salsa or guacamole if you prefer.
Joe:Hmmm. Salsa sounds great, but I’m not in the mood for anything spicy. Mayo sounds great too, but I’m trying to watch my weight. What kind of cheese is it?
Waitress:Colby-Jack
Joe:Ugh. Never mind, I’ll just have ketchup.
Waitress:I’m sorry sir, but if you actively consider alternatives then there isn’t any default. I can no longer serve you a burger with ketchup. You’ll have to have it plain.
Learn how to apply definitions in new contexts.
fifthmonarchyman: ID is not ANTI EVOLUTION. It is an argument against materialism only. As such Biologists should have no problem with ID.
Are you saying ID agrees that humans and hummingbirds share a common ancestor? If not, then that explains why the vast majority of working biologists have a problem with ID.
Zac says,
Are you saying ID agrees that humans and hummingbirds share a common ancestor?
I say,
ID could care less about common decent. As anyone who is interested is actual discussion would have known long long ago. It is silent on the subject.
Apposing ID on the grounds that some of it’s proponents deny common decent makes as much sense as apposing evolution because some of it’s proponents are materialists.
peace
Roy,
repeating your blunder will not change the facts.
There are three well grounded clusters of causal factors, natural mechanical necessity, stochastic chance, intelligently directed configuration.
It is valid to investigate phenomena by first defaulting to lawlike necessity and ruling that out on high contingency. Such has two main causes, and by applying the needle in haystack search test we may see that, reasonably something defaults to chance UNLESS it is unreasonable for chance to be credited. FSCO/I because of the scope of needle in haystack challenge, is a case of such an unless.
In this context to infer design on FSCO/I is inference to best current empirically grounded explanation after breaking two successive defaults. It is therefore not a default and it is an abuse of language and strawman caricature to so characterise the inference.
If you wish to break that inductive inference, show cause to have a fourth main category of causal factor, or else show cause that reduces three to two or one. You can do neither or you would have done it.
Empty repetition of error in the teeth of repeated cogent correction is a mark of ideological indoctrination and/or obscurantism or just playing the troll, it is not a sign of reasonable and sound thought. As it is, you are a poster-child for one of the big problems with evolutionary materialism advocates and fellow travellers.
Insofar as you have so made yourself a poster child that shows in microcosm the reality of the problem, you are inadvertently performing a service.
KF
fifthmonarchyman: ID could care less about common decent.
ID makes claims about the history of life, but ignores the one of the fundamental facts of that history.
fifthmonarchyman: Apposing ID on the grounds that some of it’s proponents deny common decent makes as much sense as apposing evolution because some of it’s proponents are materialists.
Common descent is a scientifically supported biological finding. Materialism is a metaphysics.
fifthmonarchyman says:
Fine then.
Biologists, materialists or otherwise, will have an problem with any argument that doesn’t stand up to scrutiny. And the argument that because evolution only works (and it does) by virtue of Active Information intrinsic to the fitness function implies a Designer is not an argument that withstands scrutiny.
If IDists want to infer a Designer from biology (or indeed, the natural world in general) then they need to make an argument that stands up. Failing that, all we can say is that we don’t know. And in my view, for reasons I have given, the Ewert, Dembski and Marks argument doesn’t stand up. The necessity for what they call Active Information and which I call Environmental Feedback for effective evolutionary processes to work does not imply that a Designer is necessary.
You yourself just argued that evolution was incapable on its own of finding a target. So I don’t think it is a straw man! But if I misunderstood you, I apologise. We seem to agree that evolution may well be capable of producing well-adapted organisms.
Peace to you too
Roy, We all know that you can make up absurd scenarios. Dictionaries are your friend and obviously you have no idea what “default” means.
Zachriel (attn EL et al), The design inference is compatible with common descent and with universal common descent; a certain Michael Behe is a case in point on this. Common descent all the way up to universal common descent, is compatible with intelligently directed configuration of first life and of major forms thereafter including our own. And in fact the co-founder of modern evolutionary theory held this view as his The World of Life so plainly states. It is suggested that you scroll up to the resources tab and read the relevant weak argument correctives. What ID is not compatible with is what most people who believe in “evolution” are also not comfortable with: a priori imposition of ideological evolutionary materialism, whether or not it wears the lab coat. The word “evolution” has many meanings and too often advocates slip and slide from one to the other. KF
Zachriel:
If by common descent you mean humans give rise to humans, then yes. OTOH universal common descent can’t be tested so it can’t scientifically supported.
at Zachriel,
You sir are a troll. Your only purpose here is to derail and distract.
I would hope people here know I would not make that sort of charge on a whim.
I’m going to go away for a while and hope the crowd gets better.
peace
Elizabeth:
We have. OTOH you cannot do so for your position. You don’t even seem to understand what is being debated even though it has been pointed out to you on several occasions.
We are still awaiting your model.
Joe, not to mention the software program to demonstrate capacity of blind watchmaker mechanisms to create FSCO/I rich features, as was promised at UD several years ago, IIRC before setting up TSZ. KF
Zachriel:
ID doesn’t care however there isn’t any evidence for that claim.
IF what you say is true then their problem with ID is personal and has nothing to do with science. If they had some science to support their position then ID would be a non-starter.
kairosfocus- THE problem is Elizabeth thinks she did so over on TSZ: Creating CSI with NS.
It is one of the saddest attempts in history but they all disagree…
fifthmonarchyman: Your only purpose here is to derail and distract.
Not at all. You had said (your caps), “ID is not ANTI EVOLUTION.” That life has evolved over long periods of time from common ancestors is a fundamental component of evolutionary theory. We understand you wish to sidestep the question, but facts don’t go away because they make you feel uncomfortable, or if they call into question your preconceptions. The history of common descent provides the historical framework for determining the mechanisms involved in those transitions.
With one exception I agree with most of the above. The exception is the word “inference”. I entirely agree that Design is consistent with all the evidence. It is the inferential arguments that I take issue with.
But I entirely agree that science should have no a priori impositions.
Zachiel:
Please reference this alleged evolutionary theory. And you don’t have a mechanism capable of producing life’s diversity- and that is a fact that you always sidestep.
Elizabeth:
When you come up with something better and testable, please let us know.
Joe, that is not even relevant to FSCO/I, which would be looking to create specifically informational strings that are directly informational-functional, or would serve as descriptions of organised wiring diagrams. It also in effect imposes a GLOBAL continent of function from 000 . . . 0 to 1111 . . . 1, as any non-zero vector will produce a product of strings of n heads, and the one that is zero will begin as soon as any one digit flips. So, it creates a strawman situation utterly not parallel to the need to have specific functional configs that cluster depending but naturally form discrete islands of function in vast config spaces. No wonder we saw so much dismissiveness when we used a 6500 reel and its exploded diagram as illustrating wiring diagram organisation; as in clumping parts in a bag and shaking and shaking will underscore the needle in haystack search challenge. This one is an example of how not to take up an issue, and little more than that, it joins the long list of failed experiments. Sad, really sad. And, now that I think I remember seeing this before and having much the same reaction. If TSZ’s denizens are still clinging to such a case then there is a major fail here on the part of the denizens of that site. KF
PS: In trying to chase “latching” as an issue they fail to acknowledge in what I saw that the major published and generally accessible cases of Weasel showed beyond doubt that once a letter became correct, it stayed that way. So whether the vrelevant algor that seems to be lost and was not accessible latched in all cases was irrelevant to responding to the evidence in hand. It can be shown — was shown years ago — that reasonable reconstructed algors will often show just that phenomenon through implicit interactions, a sufficiently low number of typical muts per string per gen, and strong reward to incremental progress to the target. And that was most explicitly in Dawkins’ description of what Weasel did. So, implicit interactive latching tendencies leading to picking “good” cases would set up what was shown in the two or three runs that were usually published in print. Where of course the most important point is, Weasel was explicitly a set target search so patently intelligent design not a model of CV + NS. Onward cases have implicit targets often through confining to already being on a well behaved island of function. This is opposite to the real FSCO/I origin challenge. But I doubt this will ever be acknowledged.
Intelligent Design is NOT anti-evolution- to wit:
With ID mutations are OK, differential reproduction is OK, horizontal gene transfer is OK. With Intelligent Design organisms are designed to evolve, i.e. they evolve by design. That is by “built-in responses to environmental cues” a la Dr Spetner’s “non-random evolution hypothesis” being the main process of adaptations.
As Dembski/ Wells said Intelligent design only has an issue with materialistic evolution — the idea that all organisms have descended from common ancestors solely through unguided, unintelligent, purposeless, material processes such as natural selection acting on random variations or mutations; that the mechanisms of natural selection, random variation and mutation, and perhaps other similarly naturalistic mechanisms, are completely sufficient to account for the appearance of design in living organisms. (Also known as the blind watchmaker thesis.)
Intelligent Design is OK with all individuals in a population generally having the same number and types of genes and that those genes give rise to an array of traits and characteristics that characterize that population. It is OK with mutations that may result in two or more slightly different molecular forms of a gene- alleles- that influence a trait in different ways and that individuals of a population vary in the details of a trait when they inherit different combinations of alleles. ID is OK with any allele that may become more or less common in the population relative to other kinds at a gene locus, or it may disappear. And ID is OK with allele frequencies changing as a result of mutation, gene flow, genetic drift, natural and artificial selection, that mutation alone produces new alleles and gene flow, genetic drift, natural and artificial selection shuffle existing alleles into, through, or out of populations. IOW ID is OK with biological evolution. As Dr Behe et al., make very clear, it just argues about the mechanisms- basically design/ telic vs spontaneous/ stochastic. (Yes, design is a mechanism.)
Now we are left with:
the only way Intelligent Design can be considered “anti-evolution” is if and only if the only generally accepted definition of “evolution” matches the definition provided for “materialistic evolution.”
However I cannot find any credible source that definitively states on the record that that is the case.
kairosfocus 222- I know but “they” still think it shows that NS can produce CSI. This is what gets my goat and one reason I respond the way that I do. It doesn’t make it right but it is one way to express my frustration with their obfuscation.
KF: “EL, you are of course predictably — it has happened over and over — ignoring something like Lewontin’s outright admission in NYRB, Jan 1997. As is pointed out above. This simply underscores the longstanding pattern, and implies the relevance of other concerns now that there are strong indications that it is not just cyber stalking anymore, it is highly likely on the ground. I need not elaborate on what hostile stalking implies, and on what enabling behaviour that provides cover entails. KF”
KF, what does cyber stalking have to do with the subject being discussed. EL has her views. You have yours. But she is not making unsubstantiated personal accusations as you are repeatedly doing. Every time you do this you put the veracity of your views in dispute. Your irrational behaviour has been pointed out several times on this thread yet you refuse to heed the correction.
I only bring this up because I know that you have much to contribute. But your recent behaviour is not helping you get your points across.
Emergentism has been discussed recently in a number of threads: e.g. here, here and here.
To say that there are few severe problems with this theory would be a gross understatement.
UP, pardon, I am not making unsubstantiated personal accusations but responding to such amounting to tort [I have kept UD's leadership in touch with developments up to today], and have laid out the framework of concerns with sufficient outline of dots and links that bring the underlying issue out. The issue with many people involved with ideological agendas is that they often get drawn into enabling extremists by — typically without realising it — providing fronts and sometimes face cards, In extreme cases, the ocean and its innocent fish amidst which the dangerous ones swim. If we pull back a little bit and look back across the past 150 years to 250 years, this has happened again and again in case after case. In this case, as I note EL hosts an objector site that has facilitated characters of a far more extreme nature and has long been a fellow traveller on sites that are the base of some who — for years — plainly use hers as a more genteel front that provides cover for slander under excuse of freedom of expression. Which, given the reality of tort, is not an absolute freedom. She herself was actually used to front one of the slanders recently used locally, which was in the context of building on a tort that took advantage of parliamentary immunity. And, the timing of this punch no 2 is exceedingly suspect, given its focal links to what has been proceeding elsewhere. As I said and say once more for record, given the things I now have to deal with that point to on the ground stalking I cannot afford the luxury of not connecting dots. I have little choice but to deal with such a “coincidence” as a 1-2 punch combo. KF
KF:
This in itself is a potential slander, KF, unless you support your accusation. What on earth are you talking about?
KF: “UP, pardon, I am not making unsubstantiated personal accusations…”
I don’t see how I can interpret in any other way. You are making accusations without any supporting details other than your words. You claim to be justified and expect us to simply accept your word. Unfortunately, when you accuse someone of serious and unlawful actions, there is an obligation to either provide the evidence to support the accusation or to apologize for making an unjustified accusation. Your words, if not substantiated, are themselves libellous and illegal.
I am not saying that you are not experiencing cyber stalking. But this is not the venue to air your grievances. if you are unable to debate EL in a civil fashion then my counsel would be to refrain from commenting. I have found that I have never gotten myself into trouble by keeping my mouth shut.
JohnnyB and Aurelio Smith, I apologize for temporarily derailing this thread. I assure you that was not my intent but I could not sit back and let someone openly slander another commenter. Having heated discussions over philosophy and science is a good thing. I can even tolerate abusive name-calling because that reflects on the person being abusive more than on the person being abused. But making unjustified accusations about illegal activity goes beyond the pale.
I was hoping that the site moderator would intervene, but that obviously did not happen. Since the moderator does not have any issues with the accusations made by KF I must assume that I am the one who is off base and I formally apologize to UD and all the commenters. I will not bring up the subject again.
EL @ 183:
That is exactly right Dr. Liddle. The materialist says subjective self-awareness is an emergent property of the central nervous system and there is some supervening going on in there too, of course. They must go on to say that atheist Thomas Nagel was just wrong when he said that an explanation must be systematic. They think they can just invoke some supposed brute fact like “emergent” as if that is an explanation rather than something that calls for an explanation. Nagel was right though. The so-called explanation is on an intellectual par with saying “It’s magic!”
The repeated error here (de fault?) is yours. “Default” has multiple shades of meaning, and no matter how often you aver that one of them does not apply it won’t mean that none of the others do either.
If there are multiple possible options, and all but one are eliminated by whatever means, then the remaining option is chosen by default. If these options are always examined in the same order, then the last option is the default because it never needs to be investigated. This definition of “default” – #4 on your list – is the one applicable to design in Dembski’s filter.
Note that this is not just my choice of words, but many others too – including this one from a book edited by Dembski himself:
This is my last post on this subject. If Dembski’s own book doesn’t convince you, nothing ever will.
Roy
default:
Also Dembski shows the EF requires two conditions to be met, only one of which is the elimination of necessity and chance. Design doesn’t win until that elimination takes place but also a specification exists. What book and page is that quote from?
: Elizabeth Liddle
: @30
When you first kick off an evolutionary algorithm, where does the original population come from? How is it generated?
In what sense is the initial population closely related or in any sense like their parents? In fact, what even makes them part of the same population? It seems to me that initial population is about as orthogonal as you can get.
For a reason. By design.
EL: I didn’t say that life does not “appear designed”. What I did so is that it does not appear designed for any other purpose than its own perpetuation.
That’s sort of what it means to be life, isn’t it?
Barry wrote:
Yes, the concept of emergent properties is what I am referring to. I don’t find supervenience a terribly useful concept.
Not sure what you (or Nagel) means by “systematic” here. Certainly an emergent property must be explained in terms of the system; an clearly an explanation must be “systematic” in the sense of specifying a cascade of mechanisms. So I’m not sure in what sense a “materialist” would say that Nagel was wrong to say that an explanation must be systematic. But perhaps there’s a layer meaning to that word I’m not picking up on.
Well, I’m not sure who “they” are in this context, but, clearly, “emergent” is not a “brute fact”. It’s a simply a word to denote the idea that when a whole has properties of a whole that are not possessed by the parts, those properties “emerge” from interactions between the parts (and of course between the whole and its environment). It is not itself an explanation – to be an explanation you would have to provide a putative mechanism by which those properties were generated. For instance “white” is an emergent property of water molecules when they are configured as snow crystals. Simply saying that “white” is an emergent property does not tell us how that property emerges, nor even that the property is emergent. After all “white” is also an emergent property of white paint, but it is not emergent – it’s the property possessed by the pigment suspended in the paint. So the claim that consciousness is an emergent property of the materials of our bodies is not an explanation – it’s a conjecture. But as such it is not inherently impossible – materialists do not deny that emergent properties exist, i.e. they do not insist that a person is “no more than” a bag of chemicals. They say that a person is much more than that. Where they would disagree with you is over whether that “much more” is emergent or extrinsic, I guess.
Well, “it’s emergent” would be. To support an emergent hypothesis you would have to provide a description of the putative processes by which the property emerges. So I agree with that. But I don’t think anyone who argues for consciousness as an emergent process thinks that saying that “it is emergent” constitutes an explanation. The books that have been written on the subject spend many chapters on how the authors think the property is generated!
Mung wrote:
It is written by the programmer. Often it is the simplest possible virtual organism that has the property of self-replication with variance. Sometimes it will have additional properties, if the programmer has some clue as to how the problem might best be solved.
They don’t have parents. They are created ex nihilo by the programmer.
Orthogonal to what?
Mung: Elizabeth does not understand the argument and therefore is unable to produce a meaningful challenge calling for anyone here to defend it.
Elizabeth Liddle @123: Well, no. As I understand that passage, Ewert et al are saying that yes, evolutionary models work, but they do so by virtue of Active Information.
And I see it as just the opposite. As I see it, they are saying that evolutionary models fail because they fail to deliver the goods. They fail to deliver design without a designer.
So you see DEM as saying evolutionary models work and I see them as saying evolutionary models fail to deliver as advertised. Probably not a good basis for constructive dialog.
Here again is the comment from their paper:
…the metabiology model parallels other attempts to illustrate undirected Darwinian evolution using computer models.
So when they say the model “works” they likely don’t mean it in the way you take it. And that’s a very important distinction.
So can we agree that the models do in fact fail to illustrate undirected Darwinian evolution? If you can grant that I will grant that the models “work” as long as it’s understood that to say that the model works is to say it does not demonstrate undirected Darwinian evolution.
Well, if that is what they are saying, then they are incorrect. Undirected evolution works – that’s why people use evolutionary models to develop solutions to intractable problems – problems to which they do not know the solution in advance, and so cannot transfer the solution information to the system.
And yet workable solutions emerge. So it works.
Dembski claims they do so because additional information is “smuggled in” via the fitness function. But that information is NOT the solution. The designer does not know the solution. The designer only knows the problem. So the designer cannot “direct” the solution.
And yet it works.
Sure, she designs the problem – by designing the fitness function. But that does not make the process “directed”. It simply means that the solution that is found will be a solution to the problem she wants solved.
If by “consciousness” is meant an agent who has overview and the ability of conscious top-down intervention in the course of events that brain chemistry was determined to do on the basis of natural law, then the comparison you offered is of no relevance at all—obviously the color white cannot reach down in the snow and do anything.
How “much more than that” do you claim that an “emergent property” can be? What are the capabilities of this “emergent consciousness” and how do you ground them?
Elizabeth- No one uses undirected evolution to solve anything. Evolutionary models use directed evolution to solve problems. Only directed evolution works.
No one but the fools are fooled by you.
Mung:
Mung:
That’s sort of what it means to be life, isn’t it?
In a materialist world
Jon Bartlett writes
I’ll treat this as one point as I think it is essentially the same point. DEM do not mention needing “surprising sets of mutations” to get “true jumps in fitness” or to get “recursivity”. In fact I”m not sure what you mean by it in the context. (I doubt your are referring to Professor Shallit’s blog). Also “macromutation” sounds suspiciously like “saltation” and Goldschmidt’s hopeful monsters. You also seem to be sucked by the metaphor of the fitness peak. The evolutionary landscape changes and populations of organisms can stumble over saddles and bridges that form and fade.
I see Elizabeth Liddle and SimonLeberge have both addressed this. Why should some arbitrary limit be pulled from thin air?
This is a personal foible of mine. In considering evolutionary processes, some issues are clearer when looking at simpler examples. Plants are hugely important in the biosphere. No plants means no animals including us. The ways in which (the vast majority of land-)plants exploit their environment cannot be done by thinking (no nervous system) or moving (no musculature etc) yet clear a patch of ground and wait. Are plants actively exploiting the opportunity?
I’ve said evolutionary processes are not searches.
That’s a default argument along the lines of “if we can’t think of an answer we should stop looking.”
Yes well Denis Noble is currently promoting a third way. Glancing through Elizabeth Liddle’s blog, I see she considers Noble to be on to something. I’m not so sure. Not dismissive, just not so sure.
Not to worry. It’s not as if you were the prime instigator.
EL, pardon, but maybe you have forgotten the vampire clergyman caricature video associating that distorted image with war mongering and promoting genocide that I critiqued three years ago; where you joined others in a dismissive chorus to pooh-pooh the concept that this was in context an outrageous and blatant scapegoating, slanderous stereotype? This exact case was used to try to attack me locally, and became a part of a much wider and nastier tort. As I have pointed out over several years now, you have provided seemingly respectable cover for things you would not believe could be done; I won’t bother to give specific historical antecedents as they would predictably be twisted by the unhinged. In this case, I am dealing with stalking that looks a lot like it now has an on the ground component that if I were the worrying kind, would have me in a panic, stalking joined to outing that tries to paint me as an abuser, fraud and consorter with criminals of the worst sort. This, in the context where I am dealing with a slanderous abuse of privilege case.Where, in a 24 hour window I have faced what my experience of trained agitators and their shennanigans tells me looks a whole lot like a 1-2 punch game, and in any case has to be treated as such. So, please just back off on the apparent turnabout accusation attempt; right now I do not have the option or inclination to let things pass. Not when I have had to be dealing with apparent on the ground stalking and defamation that is now spreading to remotely connected people, not just my immediate family. Including, for instance a rehabilitated murderer out on parole after over 25 years in gaol and coming within an ace of being the last murderer executed in this territory . . . they were literally practicing with the assembled gallows outside his cell window when a man of God told him no, God would give him a second chance. The order of cessation came through and as he told me, that had a transformational impact on his life. The jokers playing with spreading lies and using sites such as yours and those you have participated in as cover, need to understand what such accusations motivated by their uncalled for hostility could do to such a man who for life has to meet with a parole officer on a regular basis. And that is just one facet of this dirty situation. As I have pointed out to you and others freedom of speech is not a license to slander, and harbouring or associating with those who slander like this and stalk like this online and now apparently beyond that, is enabling behaviour. I warned you years ago, more than once but you brushed it aside. Now, it is escalating and with all due respect, you and others have some serious explaining and correcting to do given what is going on and the 1-2 punch timing I can see. KF
Under evolutionism evolutionary processes are not searches. That is one reason they are impotent. Also fitness, wrt biology, is reproductive success, which may or may not be related to physical fitness. Not really a good metric.
Natural selection can’t even produce the different breeds of dogs. Drift is totally impotent, which is why Darwin barely discussed it.
So even if you prove DEM to be wrong, which you haven’t, you still have nothing to offer.
Ever notice how some people find it convenient to appeal to the organism/artefact distinction, while at other times and in other contexts, when it’s not longer convenient to do so, choose to forget all about it? Is that rational?
Don Pedro @76
Computer programs are artefacts, as are the entities in those programs.
Elizabeth Liddle @77
So much for evolutionary algorithms then.
Dr. Liddle @ 236:
Yes, you misunderstand. Nagel insists that an explanation – to count as an explanation – must be systematic in exactly the sense you state. Thus, it is the hypothetical materialist who resorts to the asserted brute fact disguised as an explanation who must believe Nagel is wrong about that.
Just so.
Well put. Who knew you were an Aristotelian? You are saying that the actuality “water” has the potency “white” under certain conditions. Careful; it is not that far from Aristotle to belief in God. The very dichotomy to which you indirectly allude (act; potency) leads inexorably in that direction.
You astonish me. Most of the materialists who post on this site would disagree with you. They absolutely insist that simply saying the word “emergent” counts as an explanation. I apologize for assuming you would make the same error.
Of course materialists insist that a person is no more than a bag of chemicals. That is indeed the essence of materialism. If STEM (space, time, energy, matter) is all there is, then by definition, “bag of chemicals” exhausts the possibilities. Yes, one bag of chemicals may be configured in a different way — or pattern if you like — than another bag of the same chemicals, but both bags are nothing more than bags of chemicals.
As I said, by definition, they do not; at least not while being logically coherent they don’t.
No, they would disagree with you when you imply there is something more than a bag of chemicals in a bag of chemicals.
Again, we agree. May I quote you to all of your materialist friends who insist otherwise.
Yes, and this is never done.
Hundreds of experiences on these very pages to the contrary compels the conclusion that you are wrong about that.
No they don’t. Literature bluff. I call your bluff.
Also, see “Materialist Dodge 2” here.
@ KF
I consider your comments no’s 5, 19, 21, 35, 39, 82, 85, 92, 126, 129, 138, 141, 142, 145, 146, 147, 152, 172, 184, 189, 196, 201, 207, 211 as unresponsive to the OP so I won’t be responding to them.
92, 126 and 129 especially make me inclined to back away slowly.
Surely you could address these matters of persecution and paranoia in another thread.
@ Barry Arrington
Who is Thomas Nagel and what does he say about active information? Does he use the same definition as DEM?
Joe,
thanks, that’s a clear statement of the relevant definition. The quote is from The Nature of Nature: Examining the Role of Naturalism in Science; not sure about the page number since it isn’t shown on Google books.
My understanding is that any specification needs to be in place before chance can be eliminated, and isn’t needed for the final conclusion of design.
Roy
To Mung/Liz @237:
The initial population is only a simple replicator in evolutionary algorithms where reproduction has to be performed by the ‘organism’, rather than being performed by the algorithm. In those evolutionary algorithms where reproduction is handled outside of the ‘organisms’, the initial population is usually generated randomly, although it can be seeded from the results of a previous run.
Roy
Roy, I have the book so I will take a look.
explanatory filter- notice the last decision node.
@ KF
Include comment 246 in the list of comments that will not be responded to by Aurelio Smith.
I’m getting a little concerned for you. I control my internet addiction by an oven timer and walks in the countryside.
Or you could find more time for fishing.
: Aurelio Smith
: 244
Indeed you have. But Active Information is intimately related to searches.
So why not just argue that active information is irrelevant to evolution?
mung writes:
That hasn’t been established so far in this thread or elsewhere as far as I am aware. Could you (or anyone) elaborate?
It’s right there in the OP. The section titled Active Information.
mung writes:
That’s elaborating?
Let’s have a five-minute argument. No it isn’t.
Well, Barry nice to see we do have some common ground
Apology accepted
Well, no, that’s the point I’m making. A materialist distinguishes between a bag of chemicals and a person (or a banana and a smoothie, to leave consciousness out of this) but attributes the difference to properties of the respective systems, not to some externally added ingredient. Thus a banana, or even a tornado, is more than the inventory of their parts – their properties are different from those of their parts. To put it differently: a materialist recognises that wholes are different from their constituents. Not to do so would be foolish. But doing so does not of necessity entail invoking some extra ingredient that makes the whole different from a “bag” of its parts – the only “extra” thing is the pattern/configuration/system itself.
Ah. OK. Sure: the materialist would say that there is nothing “added to” the bag of chemicals to make it a banana. It weighs the same; it consists of the same set of molecules. However, to say there is no additional ingredient is not the same as saying that it is “nothing more than…whatever”. A tornado(to get right out of biology” is hugely “more than” a volume of air in terms of all kinds of properties that it possesses that the air molecules do not themselves possess, and a differently configured column of air would also not possess.
It is perfectly logical to say that an object has properties (i.e. is more than) the same object pulverised but with all the bits collected together has. Sure it doesn’t weigh more – but it can do things that the pulverised object can’t. The interesting question is: what is it about the configuration of parts that lends an object properties that a different configuration doesn’t have? You seem to be saying that a materialist denies that the configuration matters. Or, if not, it is not clear to me what you are saying.
Well, we are probably arguing past each other for some reason. A materialist (not sure whether I count under your criteria) regards the properties of an object as deriving from the configuration of its parts – a different configuration will have different properties. So the configuration of parts is important. Sure, the materialist would say nothing need be added. But you can have two things made from the same parts that are different things, without adding something to or subtracting anything from, one of them. A robot isn’t “just” a bunch of cogs and wires and steel hydraulics, even though you could take it apart, put the parts in a bag, and no longer have a robot, even though you had all the parts.
Be my guest
I disagree.
OK, well let me rephrase: I do not know of anyone who argues that.
I don’t bluff, Barry. I have my faults, but bluffing isn’t one of them. One example is Tononi and Edelman’s book. There are others, but that is probably the book with the greatest neuroscience detail. Then of course there are Hofstadter and Dennett’s books. However, the cognitive neuroscience literature (journals) is very extensive. Karl Friston has written a lot of papers on the subject, for example. You might not find the literature persuasive, but it’s full of specific mechanisms, not just “it’s emergent”.
Barry Arrington writes (to Elizabeth Liddle):
As one can hardly complain to the blog owner about derailing threads on his own blog, let me just observe that I find it a little ironic how Ed Feser distances himself from “Intelligent Design”. If ever there was a natural ally…
Mung:
Indeed it makes sense only when something potentially informed of the “target” event generates a process in order to generate the event. An example is when someone knows the properties of a solution to a problem, exploits that knowledge to select a so-called search program, and runs the program in hope that the process will generate an object with those properties. Clearly the human problem-solver seeks a solution to the problem.
When a scientist observes an interesting outcome of a random process in nature, identifies its salient properties, and uses a computer program to model the process, subject to constraints of scientific knowledge of physical reality, the scientist is doing something very different than a problem-solver does. The probability that the model process generates the event of interest is no indication that the scientist rigged the model to do so, or that something formed the modeled process in order to generate the outcome that the scientist noted.
Roy wrote:
I think we are running into problems with terminology. Sometimes, in a computer model, the “virtual organism” is itself an algorithm – for example the developer might want an algorithm that will solve some problem. So at that level we have a population of algorithms – the phenotype is itself an algorithm. Then the organisms themselves need some kind of reproductive mechanism – that does not (usually) evolve throughout the run, but is part of the hard code. Then there is the code that delivers the “feedback” – provides the criteria as to whether the organism will mate and/or breed or die.
And at the beginning, there is a population of organisms that may or may not themselves be problem-solving algorithms (in AVIDA they are), but whose reproductive machinery is designed. From that point onwards, the organisms evolve.
I’ve been working recently with Eureqa, which evolves equations (or algorithms that include logic gates). I have been using them to classify groups of people on the basis of data I provide. The data function as the resources of environment in which the equations have to survive and breed (they are the inputs into the equations). The fitness function is very simple: equations whose output classifies more people correctly have a higher chance of breeding than equations that don’t, and those that do it more simply also have a higher chance of breeding. And when they breed, they breed with mutations.
The winning equation (the equation that best combines classifying power with simplicity) is then tested on a new population of people.
The system is not “directed” except that I specify a logistic functional form. I don’t know what the winning equation will be. If I did, I wouldn’t have to let Eureqa run for several days on multiple computers! So I don’t tell Eureqa what the target is (unlike “Weasel”). Indeed, there may be no such equation. I do provide it with an “environment” in which the equations have to survive and breed (my fitness criterion and the resources represented by my data), and the Eureqa software provides the “organisms” with their reproductive machinery (complete with random mutations).
The environment is designed (by me); the fitness function is designed (by me); the capacity of the organisms to reproduce is designed (by Eureqa developers) but the actual equations evolve. Neither me nor the Eureqa developers know what the equation is that will best classify my people into groups.
#249 Barry (to EL),
Would they really?
http://www.uncommondescent.com.....ent-545918
– and I believe more of us have summarised their understanding of “emergence” in a similar way on one occasion or another. By the way, would you be kind enough to restore my commenting rights as “Piotr”?
EL @ 260:
Of course you do. You just did and I called it.
One literature bluff followed by another. I call that one too. No one has set forth a demonstration that comes close to (in your words) “specifying a cascade of mechanisms.” If they had, they would have solved the hard problem of consciousness. You resort to MD2. That’s OK; if that makes you feel better be my guest. Just know your first bluff and your second bluff have been called. If all you’ve got is literature bluffs, let us agree to conclude our dialogue. Good evening.
Barry: “One literature bluff followed by another.”
I am confused. Do you not consider literature, articles, research papers to be appropriate evidence to support one side of an argument or the other? How is that a bluff? You can always disagree with the conclusions of the literature, or the assumptions they are based on, but it seems to me that you can’t simply declare it a bluff and dismiss it. After all, we would not dismiss the Bible as bluff simply because it is literature. Or maybe I don’t have the background that leads you to make this statement.
Well, as I said, Barry, you may not find the literature persuasive. That does not make it a “bluff”.
Regarding “The Hard Problem of Consciousness” – there is a serious debate not about whether it has been solved (if Chambers is right it won’t be), but as to whether the problem is even, by Chamber’s definition, “Hard”. Some people (and I am one) think Chambers’ question is simply ill-posed. But again, that has nothing to do with bluffing. I cited literature that in my view supports my case that arguments for consciousness being an emergent property are not merely “it’s emergent” but a whole literature of detailed proposed mechanisms.
That you find them unconvincing does not make me dishonest. It simply means we disagree on the nature of the question.
Beyond eccentric: Lizzie truly believes that the details have been identified how to get from chemicals to consciousness.
Also the OOL problem will be solved any moment now:
Box, I didn’t say that I believed that the details have been identified how to get from chemicals to consciousness. I don’t.
Barry claimed that arguments that consciousness is an emergent property of matter amount simply to the assertion that “it’s emergent”, and I agreed with him that that would clearly be inadequate; that anyone claiming that consciousness is an emergent property would have to provide an actual explanation.
He challenged me to cite people who did. I gave him some examples. He accused me of “bluffing”. Whether or not those examples are enough to persuade Barry, or you, or me for that matter is not the point – the point is that those making the argument are not regarding the claim that “it’s emergent” as sufficient to make their point. They also provide putative mechanisms, in considerable detail, just as I said they did.
Of course I don’t claim that “the details have been identified how to get from chemicals to consciousness”. I find the arguments interesting, and I tend to side with those who regard Chamber’s “Hard Problem” as ill-posed. But as someone who actually works in that field, I know all too well how rudimentary our understanding of cognitive mechanisms actually is.
And I do not appreciate being accused of dishonesty. As I said, I have my faults but bluffing isn’t one of them. I say what I think, and can see know point in pretending to know something I don’t.
Materialism can’t even explain organisms so how can it explain consciousness?
Has a rough outline been identified how to get from chemicals to consciousness?
Aurelio Smith @251:
Shouldn’t you know the definition of active information as given by DEM before asking such a question?
@Box: In my view, yes. But to some extent it’s a philosophical issue – if you accept Chalmer’s formulation of the Hard Problem then no. I don’t buy his formulation. I think it contains a philosophical error. But I’m not enough of a philosopher to be able to articulate just where it is, and I could be wrong! But I think the essence of the answer lies in our capacity simulate the outputs of our actions before we execute them and feedback those outputs as inputs into the action-selecting process. That allows us to both anticipate and remember in what Edelman calls a “remembered present”, in which past and possible futures are integrated.
But that should really be for another thread! This one is about Ewert, Dembski and Mark’s concept of Active Information.
unwilling participant @ 266
UP, of course literature, articles, and research papers are appropriate evidence to support one side of an argument. You don’t seem to understand the nature of a literature bluff. As a service to our readers we have provided helpful descriptions of many of the Darwinian Debating Devices. The one EL employed here is described in Darwinist Debating Device #6: “The Literature Bluff” That post contains a detailed discussion of the literature bluff. In summary, it goes like this:
Darwinist: There are thousands of books and articles demonstrating Darwinist proposition X.
ID proponent calls the bluff: OK, show me exactly where in just one of those books or articles this proposition is established.
Inevitable Darwinist response: [crickets]
I will show you how it is a bluff step by step:
Step 1: Establish what we are talking about:
Conclusion: We are talking about EL’s assertion that subjective self-awareness is an emergent property of the central nervous system.
Step 2: Show the bluff.
Here is the key passage:
EL asserts books have been written in which the authors spend many chapters on how the authors think subjective self-awareness emerges from the chemicals that make up the central nervous system.
Step 3: Call the bluff.
This is simply not true. In Aristotelian terms, no one has ever even put forth a speculation about how a physical actuality (the chemicals that make up the central nervous system) has a potentiality for a mental actuality.
We are talking about two distinct and wholly separate ontological categories. Physical and mental. It is literally incoherent and absurd to even suggest that a physical event can result in mental event, as I explain in detail here.
UP, it is not that I don’t find the literature persuasive. I find it non-existent. And EL is simply bluffing when she says it does exist. Notice the telltale feature of all literature bluffs: When EL’s bluff was called, she did not even attempt to summarize any of the mechanisms she says these authors have identified. Why? Because she can’t. No such mechanism has ever been identified (and never will be).
Why can’t I declare it a bluff if it is in fact a bluff?
This statement is based on misunderstanding of what a literature bluff is. I hope I have helped you.
Correct. Apparently you do not. Again, I hope this has been helpful.
EL @ 236:
EL @ 269:
Then we are right back to where we started. EL agrees that one would need to provide a description of the putative process by which consciousness emerged in order for it to account as an explanation. She then admits that no such process has been described.
Thank you EL.
Aurelio:
That is incorrect. Active information just refers to computer simulations. Its presence demonstrates the programs do not mimic unguided evolution, meaning they are guided by that active information. Actual searches actively seeking solutions and given the means, the resources and the target to do so.
Barry Arrington:
I’m particularly interested in a claim, published recently in a peer-reviewed article, that algorithmic specified complexity was introduced by Dembski in The Design Inference. The reference gives no chapter, let alone page numbers. I’m sure that the term appears nowhere. But I haven’t read the book recently enough to rule out the possibility that the concept is there, in some nonobvious form. I’ve sent separate email requests to two of the authors, asking where to look, but neither has responded. I’ve been waiting a couple weeks.
Does what I’m dealing with qualify as a literature bluff?
How to get a clue about active information
Clue 1: A notable collaborator is Winston Ewert Ph D, whose master’s thesis was entitled: Studies of Active Information in Search where …
Clue 2: In A General Theory of Information Cost Incurred by Successful Search, Dembski, Ewert and Marks (henceforth DEM) give their definition of “active information” as follows:
Clues 3, 4, 5, 6, 7 and 8:
And I didn’t even have to go outside the OP.
Clues 9 and 10:
Joe @ 276.
Thanks for that quote. It explains why Aurelio wants to rip active information as used by Dembski, Marks and Ewert out of it’s context in searches.
Since he doesn’t think evolution is a search that’s what he’s been reduced to.
Barry: “Then we are right back to where we started. EL agrees that one would need to provide a description of the putative process by which consciousness emerged in order for it to account as an explanation. Then then admits that no such process has been described.”
But how is this any different than those of us who believe in ID not being able to describe the putative processes by which consciousness arose through ID? It seems to me that we are expecting a much higher burden of proof for EL’s theory than we do for ours. That is why I don’t think dismissing it as a literature bluff holds water.
Mung- It was gut wrenching reading the OP but I did it.
Heh. Consciousness was given, ie a design feature.
Umm, they say they have a step-by-step mechanism that can account for what we observe. Asking them to show us is allowed. We have a step-by-step method for inferring design and we freely show it to anyone who cares.
Joe: “Umm, they say they have a step-by-step mechanism that can account for what we observe. Asking them to show us is allowed.”
Fair enough. Could you point me to some references where they have claimed to have a step-by-step mechanism? I would love to read them.
Start with Darwin, 1859.
unwilling participant said:
I don’t know of any other ID advocate who thinks that “consciousness arose through ID”. I think most ID advocates consider consciousness primary.
If it’s not a literature bluff, EL is free to provide pertinent quotes and a description of the relevant theory and processes.
Joe: “Start with Darwin, 1859.”
As Barry would say, I think that you are using a literature bluff. Darwin never claimed that he had a step-by-step mechanism. He had the basis of a theory and a book full of observations that he thought supported his theory. He knew that there had to be a mechanism for increasing variation but didn’t know what it was. He also knew that there had to be a mechanism for inheritance but didn’t know what it was.
But I would really be interested to read any papers by Darwinists that claim to have a step-by-step explanation of all of the mechanisms involved. I must confess that my question was a trap because I doubt very much if one exists. I just wanted to again point out that we expect a greater burden of proof on Darwinist explanations than we do of ours. I realize that this is human nature but if we are to have ID taken seriously as a science we have to demand a high burden of proof for our theory as well.
UP: “That is why I don’t think dismissing it as a literature bluff holds water.”
What is the “it” to which you allude?
Mung:
I’d be happy to discuss “A General Theory of Information Cost Incurred by Successful Search,” by Dembski, Ewert, and Marks (DEM), with someone who understands it so well. I’ve addressed a couple of comments to you previously, but you haven’t replied. One question I believe I left you: What measure of information do Ewert, Dembski, and Marks apply in “Active Information in Metabiology”?
Dembski and Marks have been through three definitions of active information. Dembski has indicated that he plans to stick with the third (DEM). But he and his colleagues have yet to use it in an analysis of “evolutionary search.” The definition that Ewert gives in his thesis is obsolete. However, he doesn’t use it in his analyses of “searches.”
Hint: A search no more searches than a screwdriver drives screws. (We commonly name tools for the purposes to which we put them. One shouldn’t take the names literally.) It depends in no way on the target, so it can’t possibly search for the target. That’s the essence of why it reduces to an Omega-valued random variable X_S, where Omega is the search space (DEM p. 12, marked p. 37).
Goodness sakes:
No, they claim to have a step-by-step mechanism capable of producing life’s diversity. We ask to see it. They balk.
Joe: “No, they claim to have a step-by-step mechanism capable of producing life’s diversity. We ask to see it. They balk.”
Who claims? Please provide a reference. I hope that you are not claiming that the paragraph you quoted above is a claim about step-by-step mechanisms.
We are not going to win arguments by falsifying claims that we say they make. We have to make sure that the ID theory is built on a solid foundation. We don’t do that by making false claims about people who honestly hold a different view.
Darwin claimed:
That would mean he is proposing a scenario in which complex organs could be formed by numerous, successive, slight modifications.
Have you no idea what is said about evolution in biology textbooks? Really?
Joe:
We obviously are not reading the same quote. He is simply stating that if any complex organ could not be created by successive steps that his theory would fail. He is not proposing the step-by-step mechanisms involved. In fact, he is as much as saying that he doesn’t know what they are.
I am not a Darwinist but how does ID benefit by you making false claims about what Darwin or other Darwinists are claiming. If you are going to make a claim it should be one that is easily verified. This issue is too important to lose because ID supporters misrepresent the facts to support our views. The ends do not justify the means.
Natural selection is that step-by-step mechanism. Easily verified by reading any biology textbook.
He is making that statement because of what he is proposing.
Joe: “Natural selection is that step-by-step mechanism. Easily verified by reading any biology textbook.”
I am by no means an expert on evolution but even I know that natural selection is not a step-by-step mechanism. Any more than ID is. To be fair, if we are going to demand the step-by-step mechanisms underlying natural selection before we will acknowledge it as a viable alternative to ID, we should also be demanding it of ID. But we don’t. Which, in my mind, is the biggest weakness of the ID argument.
You seem to be having difficulty understanding how Constructor Theory is fundamentally different. Constructor theory is not about specific constructions or constructors. It’s a theory of which transformations can be cause and which cannot. As such the answers the theory provides do not depend on what the constructor is.
From this paper on Constructor Theory.
If you have problems with abstractions as causes, you can simply replace “cause” with “can cause” or “codes for”, if you like. However, this does not prevent an actual problem for constructor theory as a more fundamental theory, in practice.
First, that’s simply not part of constructor theoretic explanations. Nor is it necessary for its success. That’s what makes Constructor theory more fundamental.
Second, that seems to be philosophical position, not an empirical fact.
Joe wrote:
What you’re describing would be knowledge about what mutations, HGTs and other responses should occur in specific environments for specific organisms. IOW, you seem to be assuming that knowledge was somehow already present from the start, such as inside the organism or part of some design laws of physics.
In the case of the former, did the most simple organism contain the knowledge describing the entire gamut of changes for every organism that would eventually evolve, in every environment, including the most complex that exist today? where is that knowledge stored in the cell? How is it encoded? How would that be simple?
In the case of the latter, the paper I referenced explains how this is possible under no-design laws, which represents the absence of that knowledge already being present in the laws of physics itself.
To quote the paper…
Joe wrote:
Darwinism has always been the explanation that the knowledge of how to build copies of organism was genuinely created, rather than having already existed at the outset. That’s the key difference.
Barry wrote:
Barry: I do not “admit” that “no such process has been described”. Such a process has been described in all the sources I mentioned, and in many journal papers. In other words, we have a proposed explanation, not merely an assertion that “it’s emergent”, which is what you claimed, and which, I agreed, would not be an explanation. We certainly do not have “the details” – what we have is a explanatory model, and which, like all scientific models, is provisional.
The problem with the explanation, however, is that unlike most topics in science, there is controversy over whether the phenonomenon it seeks to explain, consciousness, can ever be operationally defined, i.e. defined in such a way that its presence or absence can be objectively detected. Without such a definition, no theory of consciousness can be tested. That is why Chalmers described the problem as “Hard” (not merely “hard”).
So the Hard Problem of Consciousness, as formulated by Chalmers, can never be “solved”, and there is no literature that anyone can ever cite that will tell you that it has been. Any explanatory model must be predicated on a different formulation of the problem. So any scientific solution to the problem is only as good as the philosophical formulation it is premised on, and, as I said, that in itself is controversial.
But the issue isn’t (as you claimed) that people have tried to palm off “it’s emergent” as an explanation. Emergent properties abound in scientific models, and nobody that I know of would consider merely labelling a property as “emergent” as constituting an explanation for that property. For instance “suction” is an emergent property of a tornado, but nobody expect “suction is emergent” to constitute an explanation for why tornados are able to lift heavy objects high in the air.
And it was to counter that claim of yours (that people were palming off “it’s emergent” as an explanation for consciousness), that I presented you with literature in which actual explanatory models are offered. These are fairly convergent, in fact, and as I said earlier, tend to involve the re-entrant looping of simulated output back as input into action-selection processes. Therefore I did not lie. I do not lie.
But they cannot constitute a solution to Chalmers Hard Problem, because it, by definition, cannot be solved empirically.
[It might be worth moving this side discussion to its own thread - it has nothing to do with the OP.]
Sounds like a literature bluff.
Mung ask:
From my OP quoting DEM:
I asked who is Thomas Nagel (I assume you are referring to the lawyer/philosopher) and what he has to say about “active information”. My research turns up absolutely nothing. So I’m puzzled why anyone is referring to Nagel in a thread about “active information”.
Lizzie,
At what point in your description does consciousness come into existence? Can you break it down in steps? And can you highlight the step where chemicals reach the state of conscious awareness?
// follow up #302 //
Lizzie,
If such a step by step explanation from chemicals to consciousness could be provided—it cannot—, it would not be part of emergentism.
By referring to the existence of irreducible properties and postulating that consciousness is an irreducible (emergent) property of the brain, emergentism suggests that consciousness cannot be explained by its parts on principle—that’s what “irreducible” means. IOW if emergentism is true then by definition there cannot be a step by step explanation.
You have stated, several times, that emergentism is not just “it’s emergent”. You are however mistaken, that is exactly the very essence of emergentism.
AS,
In 141 above, I have had occasion to draw attention to your track record of tagging and dismissing categories of evidence, and so I am unsurprised to see at 250 above:
(And BTW, dealing with actual defamation and stalking, coming from your side and from agitators/activists cossetted by TSZ as a genteel front group, is not paranoia. Given the known Bill Clinton 1-2 punch tactic, the timing and focus of this thread are not something I can take as coincidental given actual implicit threats along the lines of we know you, where you are, those you care for to remote degrees and we are there on the ground scouting/stalking. And more. So, kindly put away your dismissive tagging.)
Now, let me clip from the linked at 141 above, some of your previous declared views as this provides context to address the sweep all away stunt in 250 above:
http://www.uncommondescent.com.....ent-560937
Onward 1:
AS, 64: I think religions have an emotional appeal that some people are more susceptible to than others. For those that succumb to that emotional need, evidence is superfluous. Those that lack that need aren’t swayed by testimony. Whether they might be impressed by evidence other than testimony is yet to be tested.
AS, 176 [in reply to a challenge as to what research he has recently done on religious evidence): AS: None, recently. Where do you suggest I start, bearing in mind that testimony isn’t going to cut it for me?
Onward 2:
AS, to Timaeus, 15: Rebuttals of what? The simple fact is that religious dogmas are made up. They have no existence in reality beyond human imagination. The boot is one the other foot. If you have evidence of the objective reality of some religious concept, then, bring it on.
In short, on fair comment, you here show the fallacy of the ideologised, closed mind. Multiplied by the sort of unfeeling dismissive contempt in the face of those who face the sort of activism that too often accompanies New Atheist agendas that I have already had to point out. Where, patently the attempt to brush aside inconvenient testimony and record wholesale is selective hyperskepticism. And as the linked will show, when challenged on substance your resort has been more of the same.
Accordingly, I will respond now for record, bearing in mind the tendency -- for years to come -- to snip out and twist exchanges in threads like this to set up, smear and burn strawman caricatures to cloud, confuse, poison and polarise the atmosphere for discussion. Why do I say this? At the heart of the defamatory remarks by one of your activists who runs a hate and attack site that targets UD, was appeal to out of context snippets and twisted summaries of a UD thread from 3 years ago. Thankfully, I was able to link to my comment no 9 in the old UD thread that gave the lie to the smears.
So, I speak now for record:
#5:
If you observe the title of the thread, it is about signal to noise ratio at least by contextual allusion.
It also refers to information and other technical considerations that need to be set in context for reasonable discussion. Where also, the very fact that signal to noise ratio, noise factor/figure and temperature exist as key metrics in t/comms implies that signals can be distinguished from noise by observable characteristics and that inference to signal is inference to intelligently created message where noise is a distinct possibility, that is a design inference on an explanatory filter is embedded in the heart of a major field of science and technology.
Accordingly, I clipped substantiating documentation from my always linked note.
#7:
This specific response to errors in the OP was skipped over in your sweep-away list, buried in silence. I reproduce it here in full so the onlooker can see the strawman caricature game at work on two levels, direct in the OP and indirect by material misrepresentation of what I had to say early in the thread in direct response to the errors of the OP. Notice, this also encloses an entire weak argument corrective, no 30, which replies to the rhetorical gambit in the OP that WmAD "dispensed with" the design explanatory filter:
>>AS, in OP:
Dembski published The Design Inference in 1998, where the ‘explanatory filter’ was proposed as a tool to separate ‘design’ from ‘law’ and ‘chance’. The weakness in this method is that ‘design’ is assumed as the default after eliminating all other possible causes.
I am sorry, to misrepresent design as a “default” in the OP is a loaded strawman caricature of the design inference process.
Let us go to a dictionary, here CED:
default (d??f??lt)
n
1. (Law) a failure to act, esp a failure to meet a financial obligation or to appear in a court of law at a time specified
2. (Banking & Finance) a failure to act, esp a failure to meet a financial obligation or to appear in a court of law at a time specified
3. absence or lack
4. by default in the absence of opposition or a better alternative: he became prime minister by default.
5. in default of through or in the lack or absence of
6. (Law) judgment by default law a judgment in the plaintiff’s favour when the defendant fails to plead or to appear
7. lack, want, or need
8. (Computer Science) computing
a. the preset selection of an option offered by a system, which will always be followed except when explicitly altered
b. (as modifier): default setting.
vb
9. (Banking & Finance) (intr; often foll by on or in) to fail to make payment when due
10. (intr) to fail to fulfil or perform an obligation, engagement, etc: to default in a sporting contest.
11. (Law) law to lose (a case) by failure to appear in court
12. (tr) to declare that (someone) is in default
[C13: from Old French defaute, from defaillir to fail, from Vulgar Latin d?fall?re (unattested) to be lacking]
In other words, something that is only resorted to on eliminating TWO first resorts, in a context of a justifiably finite and restricted list of possibilities is the OPPOSITE of a default.
Where, from Plato in the Laws Bk X 2350 years ago on, it has been well known that phenomena routinely come as produced by one or more of chance, mechanical necessity or intelligently directed configuration. That is a strongly established fact.
Mechanical necessity produces low contingency regularity under sufficiently close initial circumstances. That is its signature and the launchpad for seeking explanation per mechanical laws such as F = m*a or F = G m1m2/r^2 etc. This is foundational to the rise of modern science.
Next, and particularly in light of the study of matter at molecular scale, in the past two centuries, it was recognised that statistical behaviour reflective of chance was also to be reckoned with, so chance was admitted and is readily recognised from stochastic patterns. In comms contexts we know the familiar flickering grass on the CRO screen, and things like white noisem flicker/pink noise, shot noise, Johnson noise in resistors etc are well studied phenomena. More broadly, chance can be seen as resulting from clash of uncorrelated causal chains leading to unpredictable outcomes beyond some distribution or other (flip 1,000 coins, and see the binomial distribution emerge . . or, ponder a 1,000 atom paramagnetic substance in a weak B field that would give parallel/antiparallel alignments). Or else, many quantum phenomena seem to be directly stochastic.
The third factor is the kind of intelligently directed configuration you used to create the OP.
The three are distinct, no one has reasonably been able to say collapse design into chance and necessity per an observationally justified adequate causal process, i.e. something that meets the vera causa test of Newton acknowledged by Lyell and Darwin.
The design inference explanatory filter (especially in per aspect form) then exerts two successive defaults. First, mechanical necessity.
This breaks where high contingency on initial conditions is observed for a given aspect of an object, phenomenon, process etc.
For example, a die is a heavy object and routinely falls at 9.8 N/kg on being dropped under typical circumstances. On hitting the table etc, a butterfly effect process ensues due to eight corners and twelve edges. This shows a low contingency aspect and a high contingency one. The latter leads to tumbling and settling to a value in a flat random distribution, for a fair die.
So the second default is blind chance leading to some reasonable distribution of possible outcomes.
But when outcomes are highly contingent and fall well outside the reasonable expectations of chance and/or necessity due to FSCO/I, then we have an empirically and analytically well warranted adequate cause. Intelligently directed configuration, design.
So, the design inference process is reasonable and not at all like the strawman “default” you presented in the OP.
That you make such an error at almost the outset of your considerations drastically undermines your further case.
I suggest you correct it.
KF
PS: You then proceed to the clip from a remark that Dembski subsequently explained and emphasised its compatibility with the explanatory filter approach, as is discussed in the weak argument correctives under the resources tab, top of this and every UD page. I cite no 30:
Resort to such weak talking points progressively undermines the credibility of the objection argument being made. >>
It is fair comment for me to say that at no point in the thread above have you or those of your ilk properly responded to this. (Roy’s lame attempts to redefine “default” that appear drumbeat style throughout the thread despite multiply being corrected, are not a proper response. And BTW that makes a seeming side issue central.) So, omission of this, alone, is sufficient to conclude that the strawman caricature fallacy is at work.
# 9:
This, again, was consigned to the round file to be forgotten without mention. So, let me clip this short comment in toto:
No 9, of course is pivotal. For in OP we see Felsenstein cited as pivotal and authoritative from Panda’s Thumb:
The whole of this is on hill climbing with nicely behaved fitness functions, implicitly within islands of function. That of course begs two big questions, getting to islands of function and the well behaved nature of fitness functions in the teeth of Axe’s findings that “rough” funtions and getting locked in on local maxima/hills is a major problem.
You will notice I highlight the first sentence in your cite. It relates to the major begged question no 1 and the linked persistent distortion of what complex specified information and functionally specific complex organisation and/or associated information [FSCO/I] — the biologically relevant subset of CSI — are about.
Namely, that requisites of complex particular function emerging from specific arrangement and interactions of parts sharply confines the zone T of relevant arrangements from the wider space of possible clumped or scattered configs W. Namely, we see islands of function in beyond astronomical s4arch challenge seas of non function and the blind needle in haystack search challenge.
So, Marks, Dembski and Ewert are correct to highlight that there is a general search challenge that has to be faced, to bridge the sea of non-function . . . which cannot incrementally reward differential success through differential population survival as everything is non functional at this stage . . . to reach islands of function that then allow hill climbing to do whatever it can do in the face of likely rough fitness landscapes.
In short, as I have noted for years and have been consistently ignored on, the issue is not hill climbing within islands of function but finding shorelines of function to begin hill climbing.
This is also why the whole OP is implicitly riddled with an underlying rhetorical attack on FSCO/I and linked themes. That already makes your dismissive talking points and sweeping away of things that respond to this critical error, highly material but willfully dismissed and suppressed from consideration.
The whole exercise, with all due respect, by now is a grand strawman fallacy.
And that two successive pivotal comments by me are not even mentioned in your sweep away list peaks volumes and not in your favour, sir.
#12:
Another material omission, though it is formally addressed to MF:
Note the italicised and bolded parts.
The first aspect, highlights the focal context ever since Thaxton et al in TMLO 1984: OOL, for there you cannot play the game of appealing to being on an island of function and hill climbing by CV + NS –> DWM etc. Nope, origin of self replication is part of what must be explained. And this is the root of the tree of life, no root, nothing beyond.
Second, you will see I bold the issue on search for golden search. In previous discussions and int eh context of the active information argument by Marks et al, direct blind search is used as a yardstick. Why that is so, is that while golden searches that get around the problems of the sea of non function may exist, they ate in an exponentially higher second order blind watchmaker search space, 2^W not W.
This is the context in which they argued that on warrant, a flat random search will perform at a given level of likelihood, in this case utterly likely to fail. But, on average per expectation given search for search, a blindly picked search will on average be no better than blind flat random search. So, it is reasonable to use that as a proxy and yardstick for average search.
That is the basis on which they then actually quantify active information. Hence the calculations that you seem to object to.
And it is patent that the objections are driven therefore by deep conceptual distortions that fail to see the context of FSCO/I and the challenge of needle in haystack blind search of huge config spaces.
This makes all my further responses on FSCO/I, islands of function and blind needle in haystack search challenges directly relevant.
But of course, all of this is nowhere to be found in your sweep away list. they were swept away before the list was even compiled it seems.
Your argument has collapsed by this point, and we have not even got to the second item on your list.
#14:
Again, from the pre-sweep away list, and we are not even at the no 2 item on your sweep away list. Strawman caricature by omission of material points fallacies, anyone?
Unsurprisingly, it underscores the links between FSCO/I, needles in haystacks to be found on blind search and active information. This one is formally addressed to SL, but is again highly material:
Here, the links to active info and the s4s issue raised by Marks et al, are underscored.
All, long since consigned to the forget and dismiss hole.
#19:
After a long list of pre-swept away comment that give its context and relvance, we get to no 2 on your list AS. It is a reply to SL who wants a definition of FSCO/I. So, again, I clip longstanding inf that documents the meaning based on what Orgel, Wicken and Hoyle had to say long since.
The bridge to active info has been pointed out and the impact of your failure to address this has been also addressed.
Your sweep away rhetorical gambit has collapsed, being exposed as a strawman tactic. But, let us go i=on a little more.
#21:
This is a summary note in light of what has preceded, on the key questions being begged,t he other fallacy at work:
I am fairly sure the fair minded onlooker will agree with me that this is a clear focal issue and the games in play both target and strawmannise me as well as the underlying actual argument and context of Marks et al on active info; then batter, smear and burn the strawman caricatures.
The same tactics continue, but it is worth pausing one last time to highlight something else form the pre sweep away list,
#25:
Here I clipped Dembski from NFL, on the definition and context of CSI and in context also FSCO/I for biofunctional contexts. Surely, if the argument is that Dembski et al have moved on beyond CSI, explanatory filters and search etc, then what this is about must be material.
I cite the NFL clip in toto, for completeness:
>> >> p. 148:“The great myth of contemporary evolutionary biology is that the information needed to explain complex biological structures can be purchased without intelligence. My aim throughout this book is to dispel that myth . . . . Eigen and his colleagues must have something else in mind besides information simpliciter when they describe the origin of information as the central problem of biology.
I submit that what they have in mind is specified complexity [[cf. here below], or what equivalently we have been calling in this Chapter Complex Specified information or CSI . . . .
Biological specification always refers to function. An organism is a functional system comprising many functional subsystems. . . . In virtue of their function [[a living organism's subsystems] embody patterns that are objectively given and can be identified independently of the systems that embody them. Hence these systems are specified in the sense required by the complexity-specificity criterion . . . the specification can be cashed out in any number of ways [[through observing the requisites of functional organisation within the cell, or in organs and tissues or at the level of the organism as a whole. Dembski cites:
Wouters, p. 148: "globally in terms of the viability of whole organisms,"
Behe, p. 148: "minimal function of biochemical systems,"
Dawkins, pp. 148 - 9: "Complicated things have some quality, specifiable in advance, that is highly unlikely to have been acquired by ran-| dom chance alone. In the case of living things, the quality that is specified in advance is . . . the ability to propagate genes in reproduction."
On p. 149, he roughly cites Orgel's famous remark from 1973, which exactly cited reads:
In brief, living organisms are distinguished by their specified complexity. Crystals are usually taken as the prototypes of simple well-specified structures, because they consist of a very large number of identical molecules packed together in a uniform way. Lumps of granite or random mixtures of polymers are examples of structures that are complex but not specified. The crystals fail to qualify as living because they lack complexity; the mixtures of polymers fail to qualify because they lack specificity . . .
And, p. 149, he highlights Paul Davis in The Fifth Miracle: "Living organisms are mysterious not for their complexity per se, but for their tightly specified complexity."] . . .”
p. 144: [[Specified complexity can be more formally defined:] “. . . since a universal probability bound of 1 [[chance] in 10^150 corresponds to a universal complexity bound of 500 bits of information, [[the cluster] (T, E) constitutes CSI because T [[ effectively the target hot zone in the field of possibilities] subsumes E [[ effectively the observed event from that field], T is detachable from E, and and T measures at least 500 bits of information . . . ” >>
We could go on and on, but the above is sufficient to make the point and AS you patently have some serious explaining to do.
KF
PS: Mung at e278 neatly blows up attempts to wedge apart active info and the needle in haystack blind search challenge:
http://www.uncommondescent.com.....ent-561125
Mung, 278 – 279:
Very well done.
Let me clip you as a F/N to my own response to AS and the sweep away tactic:
_______________
http://www.uncommondescent.com.....ent-561125
>>
278
MungApril 25, 2015 at 7:08 pm
How to get a clue about active information
Clue 1: A notable collaborator is Winston Ewert Ph D, whose master’s thesis was entitled: Studies of Active Information in Search where …
Clue 2: In A General Theory of Information Cost Incurred by Successful Search, Dembski, Ewert and Marks (henceforth DEM) give their definition of “active information” as follows:
Clues 3, 4, 5, 6, 7 and 8:
In comparing null and alternative searches, it is convenient to convert probabilities to information measures (note that all logarithms in the sequel are to the base 2). We therefore define the endogenous information I? as –log(p), which measures the inherent difficulty of a blind or null search in exploring the underlying search space ? to locate the target T. We then define the exogenous information IS as –log(q), which measures the difficulty of the alternative search S in locating the target T. And finally, we define the active information I+ as the difference between the endogenous and exogenous information: I+ = I? – IS = log(q/p). Active information therefore measures the information that must be added (hence the plus sign in I+) on top of a null search to raise an alternative search’s probability of success by a factor of q/p.
And I didn’t even have to go outside the OP.
279
MungApril 25, 2015 at 7:17 pm
Clues 9 and 10:
Conservation of information shows that active information, like money, obeys strict accounting principles. Just as banks need money to power their financial instruments, so searches need active information to power their success in locating targets. Moreover, just as banks must balance their books, so searches, in successfully locating targets, must balance their books — they cannot output more information than was inputted. >>
__________________
Your 280 to Joe is also highly relevant:
And therefore, Joe at 276:
In short, my wedge apart point is noticed by others.
AS needs to go back and deal with all of this properly in its due context.
But, we can safely predict that such an agenda driven activist as we see from earlier dismissals of testimony, reasoned argument and “religion” will not be inclined to address matters objectively.
Let’s see if we will at long last get something different.
KF
EL, at 246 above, I responded to your turnabout accusation attmept that suggested that I had improperly accused and defamed you. I did so by pointing out a concrete example that gounds my claim. I notice, since then you have gone on to talk to all sorts of other things but seem to have walked away from a correvted grave accusation in an even graver context as if nothing has happened. That, is not good enough by a long shot. KF
PS: AS, lay off the snide insinuations, it is obvious that you do not understand and probably don’t care to understand what it is like to be subjected to years of hate driven cyber stalking and slander backed up by what now looks very likely to be escalation to on the ground stalking [based on trumpeting information that simply is not accessible online and would require local knowledge, of course twisting it into utter false accusations on abusing a business premises to consort with criminals . . . which as I have pointed out potentially harms a rehabilitated murderer who is on lifelong parole after 25 years in gaol and whose rehabilitation I support along with other people], which takes things to an utterly new level.
Box wrote:
I would say it’s a continuum, but for minimal awareness you would need enough neural architecture for the organism to be able to model its own position in time and space relative to events and objects. I’d say a Venus Fly Trap is just shy of the boundary, and a planarian worm just over it. But let me reiterate that I do not think “chemicals” are ever consciously aware (if by “chemicals” you mean molecules). The awareness resides in the system, not in the parts – in the connectivity between parts, for instance.
I am not familiar with the term “emergentism”. I used the term “emergent” in its straightforward meaning, which is the adjective we use to describe properties of systems that are not those of their parts. And so clearly, cognition is such a property, for instance, whether of a person, or of some AI machine. It’s something the whole can do, but the parts cannot, even though the whole cannot do it without the parts. And evidence from neuroscience strongly suggests that mental capacity is the result of neural function – which is why brain damage affects our ability to think, or remember, or perceive. Thus it is reasonable to call these capacities “emergent” properties of the organism, specifically arising from properties of the central nervous system.
But I’m not a philosopher, so I am not familiar with the “ism” it the notion has lent itself to. I’m not a fan of isms, frankly.
EL, kindly, cf 306 just above i/l/o 246 yesterday afternoon in reply to your projective turnaround that I was speaking defamatorily towards you. Thank you in advance for your response. KF
KF writes:
What has this to do with the topic of this thread? You are projecting, Sir. Is it your intention to drown this thread with off-topic waffle?
I’m sorry KF, I simply do not know what you are referring to. You said, apparently referring to me:
Please support this accusation.
it seems that objections to emergence confuse a type of explanation with a specific emergent explanation itself. Merely saying “It’s emergent” isn’t an explanation, it’s a classification.
For example, to determine how long it will take for water to boil, I do not need to know the initial conditions, the an exact count or the exact path of each water molecule will take, let alone that kind of detail for all of the initial external influences that act outside the tea pot. These details are completely untraceable by current day computers operating till the age of the universe. But, fortunately, in the majority of cases we don’t really care about those details. Their complexity resolves into higher-level of simplicity.
If I want to make tea, all I need to know is the mass, power output of the heading element, etc., which are easy to measure. The relationships between containers, heating elements and boiling bubbles can be explained in terms of each other, without a direct reference to the atomic level or even lower. The sort of behavior of this entire class of higher-level phenomena is quasi-autonomous, which is nearly self contained.
IOW, emergence is the resolution of explainability at this higher, quasi-autonomous level. It’s a kind or classification of explanation.
As such, It’s unclear why, even if we lack an emergent explanation for how conciseness emerges, this prevents us from staying that any such expiation would itself be at a this higher level and quasi-autonomous.
KF writes:
More projection. You are right about not caring. Please take your complaints to the appropriate authority or to somebody that doesn’t think this is all paranoia. At least start your own thread so that those that wish to discuss your paranoia can do so without being interrupted by comments about “active information”.
F/N: allow me to clip from Marks and Dembski at EIL:
__________
http://evoinfo.org/papers/2010.....Search.pdf
>>The Search for a Search: Measuring the Information Cost of
Higher Level Search
William A. Dembski
?
and Robert J. Marks II
??
?
Center for Science & Culture, Discovery Institute
Seattle, WA 98104, USA
E-mail: Robert
Marks@baylor.edu
??
Dept. of Electrical & Computer Engineering, Baylor University
Waco, TX 76798, USA
[Received September 19, 2009; accepted April 1, 2010]
Needle-in-the-haystack problems look for small tar-
gets in large spaces. In such cases, blind search
stands no hope of success. Conservation of informa-
tion dictates any search technique will work, on aver-
age, as well as blind search. Success requires an as-
sisted search. But whence the assistance required for a
search to be successful? To pose the question this way
suggests that successful searches do not emerge spon-
taneously but need themselves to be discovered via a
search. The question then naturally arises whether
such a higher-level “search for a search” is any eas-
ier than the original search. We prove two results: (1)
The Horizontal No Free Lunch Theorem, which shows
that average relative performance of searches never
exceeds unassisted or blind searches, and (2) The Ver-
tical No Free Lunch Theorem, which shows that the
difficulty of searching for a successful search increases
exponentially with respect to the minimum allowable
active information being sought.
Keywords:
No Free Lunch Theorems, active informa-
tion, active entropy, assisted search, endogenous informa-
tion
1. Introduction
Conservationof information theorems [1–3], especially
the No Free Lunch Theorems (NFLT’s) [4–8], show that
without prior information a
bout a search environment or
the target sought, one search strategy is, on average, as
good as any other [9]. This is the result of the
Horizontal
NFLT
presented in Section 3.2.
A search’s difficulty can be measured by its
endoge-
nous information
[1,10–14] defined as
Iomega = ? log2 p ………….(1)
where p is the probability of
a success from a random query [1]. [--> Note the yardstick and why it is this, my search power set analysis is shorter and simpler, the on avg claim is that searches need to be tuned to their contexts to be likely to succeed, in relevant large spaces typically all will fail if blind]
When there is knowledge about the target lo-
cation or search space structure, the degree to which the
search is improved is determined by the resulting
active information
[1,10–14].
Even moderately sized searches
are virtually certain to fail in the absence of knowledge
about the target location or the search space structure.
Knowledge concerning membership of the search prob-
lem in a structured class [15], for example, can constitute
search space structure information [16].
Endogenous and active information together allow for
a precise characterization of the conservation of informa-
tion. The average active information, or active entropy,
of an unassisted search is zero when no assumption is
made concerning the search target. If any assumption is
made concerning the target, the active entropy becomes
negative. This is the Horizontal NFLT presented in Sec-
tion 3.2. It states that an arbitrary search space structure
will, on average, result in a worse search than assuming
nothing and simply performing an unassisted search.
The measure of endogenous and active information can
also be applied in a meta sense to a Search for a Search
(S4S). As one might expect, no active information in the
S4S translates to zero active information in the lower-
level search (which means that, on average, the lower-
level search so found cannot do better than an unassisted
search). This result holds for still higher level searches
such as a “search for a search for a search” and so on.
Thus, without active information introduced somewhere
in the search hierarchy, none will be available for the orig-
inal search. If, on the other hand, active information is
introduced anywhere in the hierarchy, it projects onto the
original search space as active information.
The target of a S4S is a search algorithm that equals or
exceeds a minimally acceptable active information thresh-
old. A higher-level S4S will, itself, have a dif?culty as
measured by the S4S’s endogenous information. How
much? Previous results have shown the dif?culty of a
S4S as measured by its endogenous information is lower
bounded by the desired active information of the target
search [14]. We establish a much more powerful result.
According to the Vertical NFLT introduced in Section 4.3,
the dif?culty of a S4S under loose conditions, as measured
by the S4S endogenous information, increases exponen-
tially with respect to the active information threshold re-
quired in the lower-level search space . . . .
De?ne an assisted query as any choice from ? 1 that
provides more information about the search environment
or candidate solutions than a blind search. Gauging the
effectiveness of assisted search in relation to blind search
is our next task. Random sampling with respect to the uni-
form probability U sets a baseline for the effectiveness of
blind search. For a ?nite search space with |?| elements,
the probability of locating the target T has uniform prob-
ability given by Eq. (3) without the subscripts:
p = | T |/ |?|
. . . . . . . . . . . . . . . (6)
Let q denote the probability of success of an assisted
search. We assume that we can always do at least as well
as uniform random sampling. The question is, how much
better can we do? Given a small target T in ? and proba-
bility measures U and
? characterizing blind and assisted search respectively, assisted search will be more effec-
tive than blind search when p LT q, as effective if p = q,
and less effective if p > q. In other words, an assisted
search can be more likely to locate T than blind search,
equally likely, or less likely. If less likely, the assisted
search is counterproductive, actually doing worse than
blind search . . . .
3.1. Active Information
Let U denote a uniform distribution on ? characteristic
of an unassisted search and
?the(nonuniform)measure
on ? for an assisted search. Let U ( T ) and
?
( T ) denote
the probability over the target set T ? ? . De?ne the active
information of the assisted search as
I+(
?
| U ) : = log
2
?
( T )
U ( T )
. . . . . . . . . (7)
= log
2
q
p
Active information measures the effectiveness of assisted
search in relation to blind search using a conventional in-
formation measure. It [1] characterizes the amount of in-
formation [19] that
?(representingtheassistedsearch)
adds with respect to U (representing the blind search) in
the search for T. Active information therefore quanti?es
the effectiveness of assisted search against a blind-search
baseline. The NFLT dictates that any search without ac-
tive information will, on average, perform no better than
blind search.
The maximum value that active information can attain
is ( I+) max = ? log 2 p = I W indicating an assisted search
guaranteed to succeed (i.e., a perfect search) [1]); and the
minimum it can attain is ( I+) min = ? infinity , indicating an as-
sisted search guaranteed to fail.
Equation (8) can be written as the difference between
two positive numbers:
I+ = log2 1/p ? log2 1/q
. . . . . . . . . . (8)
= IW ? IS . [I put in W for omega]
We call the ?rst term the endogenous information, IW,
given in Eq. (1). Endogenous information represents the
fundamental dif?culty of the search in the absence of any
external information The second term in Eq. (9) is the exogenous informa-
tion.
IS : = ? log2 q . . . . . . . . . . . . . (9)
IS represents the dif?culty that remains once the assisted
search is brought to bear. Active information, as the dif-ference between endogenous and exogenous information,
thus represents the dif?culty inherent in blind search that
the assisted search overcomes. Thus, for instance, an as-
sisted search that is no better at locating a target than blind
search entails zero active information.
Like other log measurements (e.g., dB), the active in-
formation in Eq. (8) is measured with respect to a refer-
ence point. Here endogenous information based on blind
search serves as the reference point . . . >>
______________
After this, any attempt to wedge apart active information and blind needle in haystack search must be taken as an insistent resort to strawman caricature in the teeth of presented direct evidence to the contrary.
Evidence that has been on record in publif for a full five years, from the outset of publications by Marks, Dembski and co.
And again, the relevance of my swept away arguments above is further underscored.
KF
Popperian wrote:
Exactly. That’s why I don’t understand why there’s an ‘ism’ associated with it.
Any account of consciousness in terms of the physical make-up of the body-and-brain is going to be of an emergent phenonmenon, and there are plenty of models. Anaesthesia wouldn’t even be a scientific discipline if we didn’t have sound, tested models of what processes are involved, and certainly stroke medicine would be useless.
Saying that consciousness is an emergent phenomenon isn’t even controversial, I wouldn’t have thought. We might ask whether there’s some extra ingredient that gives us Free Will or Eternal Life – but then we aren’t dealing with science, we are dealing with theology. Which is fine.
But the possibility of an immortal soul doesn’t make the science of consciousness invalid.
Box: If such a step by step explanation from chemicals to consciousness could be provided—it cannot—, it would not be part of emergentism.
That something has emergent properties doesn’t necessarily mean it can’t be reduced to simpler principles, e.g. the property of wetness.
Emergentism, as a metaphysical belief, has many flavors. The most common is that all phenomenon supervene on basic physical processes, but that the relationships are so complex, that only by considering emergent properties can we hope to understand such phenomena. In other words, biology isn’t just applied physics, and any workable theory of biology has to work with emergent properties of biological organisms.
As a claim, emergentism and materialism are both supported by noting that many things once thought to be immaterial have been explained through material processes, and furthermore, believe no scientific evidence of non-material causation has been forthcoming. Consciousness, then, is a gap, just as the mechanism of heredity was for Darwin, a problem awaiting a solution.
The counter claim is generally supported by consideration of introspection, but materialists would say this is a mistaken notion, and look to evidence from cultural history and illusions associated with consciousness to explain the misconception.
unwilling participant- your ignorance means nothing to me. Natural selection is that posited step-by-step mechanism.
EL & AS, it is now evident that I am dealing with a wall of refusal to be accountable over abusive remarks. EL, in 246 above I made reference to a specific context and event where your joining in a chorus of dismissal of my critique of Aiden’s vampire clergyman video form of the so called atheist’s anthem lent cover to a slander that was taken up recently. I now wonder if three years ago you ever took time to watch that horrible video and attend to the contextual import of the lyrics before jumping in on a pile on to dismiss. In that context your stuck record dismissiveness and demand for proof already given by reference is revealing. AS, you show how too many advocates from your side hope to profit from defamation, denigration and demonisation, not caring one whit for those who may suffer collateral damage. In this case a man who served his time for a horrible crime and has made a turnaround of life with God’s help. But I suppose this is all testimonial evidence that you discard to convenience. And then turn on someone who is pointing to the dangers of enabling behaviour [facing not only cyber stalking but now likely on the ground stalking] and projecting insanity, paranoia. Shame on you sir. And FYI, years ago I went to authorities. Due to the undeveloped state of cyber law, little more than what has been done can be done. And when enablers give room to the truly unhinged haters from the fever swamps of the internet, one thing sensible people will do in the end is take due note. You have told us all we need to know about you and your ilk sir. And, madam. Good day. KF
So, you “think” that connectivity between parts may be relevant to awareness. Okay, that’s fine, but how is your idea a systematic description of how to get from chemicals to consciousness—this is not even an “rough outline”, let alone a “specific mechanism”, as you claimed earlier?
That’s rather bizarre, because you don’t shy away from “correcting” ppl on this topic, like Barry Arrington and Prof. Nagel.
I have no recollection of any “vampire clergyman video”, KF. You appear to have confused me with someone else.
Popperian @311:
From the Materialist Lexicon:
Quasi-autonomous – one of many terms employed by materialists to semantically obfuscate the fact that there is no top-down autonomy of any non-illusory sort under materialism; there is only bottom-up causation described in top-down terms.
Box:
Well, at the risk of being yet again accused of “literature bluff” I suggest you read Edelman and Tononi’s book. I’ve told you what I think the essential architecture is; their book goes into a great deal more detail about how such architecture is implemented in the human brain (although in fact since that book was written, we know a great deal more about brain networks and the way they subserve conscious processing). It’s literature, sure, but it’s not a bluff. If you read it and don’t find it persuasive, then fine. But it’s there.
I haven’t even mentioned “emergentism”, except to say it’s not something I know anything about. And I said I agreed with Nagel.
William: there are feedback loops in many systems between parts and the whole, and wholes and the part. Causal influences are not unidirectional, whether “under materialism” or not. Oddly enough, you’ve just got us back on topic, because one of the problems with the Ewert, Dembski and Marks’ analysis of evolutionary systems is that they ignore the fact that evolving populations are themselves part of the environment that are adapting to. So the “search” for optimal fitness actually changes as a function of the “search” itself!
KF,
Could you link to background info about the matter of this vampire clergyman video, perhaps in a FYI-FTR post, to avoid derailing this one? I, like quite a few others here, don’t know what you’re referring to.
EL says,
So the “search” for optimal fitness actually changes as a function of the “search” itself!
I say,
You have hit on something here. The inability of materialism to explain consciousness is directly related to the OP.
After all consciousness is the granddaddy of all targets
If I understand you. You are claiming that Evolution morphs from a search for optimal fitness to a search for a specific target (consciousness).
What you need to do is explain how this is even possible given materialism.
peace
Unless any part of that “feedback loop” is proposed as being causally independent of matter and energy behaving according to physical laws and mechanical probability, all you have done here is use the term “feedback loop” and the phrase “not unidirectional” to equivocate in exactly the same manner as the term “quasi-autonomous”.
RE the O.P, until you can show/demonstrate the environmental/nearby organism/population provides an adequate amount and the necessary kind of “active information” for categorically Darwinian searches to acquire the targets we see instantiated in biological forms, you’ve offered nothing but pure speculation.
At least DEM are attempting to quantify and demonstrate beyond mere speculation and bare possibility.
Lizzie,
I think KF is alluding to this event. It doesn’t take much to cause a paranoid meltdown in some people.
fifthmonarchyman wrote:
If I understand you. You are claiming that Evolution morphs from a search for optimal fitness to a search for a specific target (consciousness).
No, I’m not saying that, I’m afraid! I was making a much more ordinary point that the environment in which a population inhabits itself changes as a result of the evolving population(s) it contains. A classic example is the “arms race” – a male with slightly larger horns may thrive while nobody else has them, but once he’s spread his genes through the population, his descendents are going to have to need bigger horns for the same advantage. So things like horns can become unfeasibly large!
In other words causality runs from part to whole and back again – from gene to population and back to gene.
And I think you also pinpoint a real problem with the “target” terminology. The only “target” in evolutionary systems is the “target” of reproducing. Evolution (under evolutionary theory, and indeed, in evolutionary models) is not trying to reach some specific target, any more than a mountain stream is trying to reach the a specific lake. It will simply go where the next-easiest bolder is to dislodge. And if the landscape itself is changing, as a result sometimes of the river course itself, then the “target” (a lake – any lake) will change too. Hence ox-bow lakes.
Where consciousness comes in, in my view, is that it’s a pretty useful capacity to have, if you can get it. So the evolution of features that subserve consciousness will tend to confer a selective advantage.
Kairosfocus (313):
You made a poor choice of material to quote. The Horizontal No Free Lunch Theorem is not even a proposition, with the definition of search in the paper. There used to be an erratum attached. The Horizontal NFLT would have been OK if Dembski and Marks had used the definition of “search” later given by DEM. Dembski and Marks have removed the erratum. I can only suppose that they feel it’s unnecessary because they later figured out how to fix the problem. Suffice it to say that I don’t feel that way.
“Assisted search” is nothing but terminological begging of the question. According to Dembski’s authoritative source, DEM (note 8):
They had good reason to make the change. I’d advise you to stick with them.
Dear moderator, I know that I said that I would not raise the subject again but you have a commenter who is making repeated accusations of illegal activity against another commenter without a shred of evidence. This is completely unacceptable activity. In fact, there have been instances of web sites and their moderators being found legally accountable for not taking action on libellous comments such as these. I would not like to see this happen at UD.
An explanatory model with no details as to how the explanation works in practice is no explanation at all.
Let me paraphrase from above and now: “We’ve explained it even though we can’t define it.” You are deeply confused.
Now we get to the rub. We can’t explain the phenomenon on materialists terms. So we will pretend it does not exist. That is why the materialism is logically incoherent. It denies that which is known by everyone to the case.
Only someone who is deeply ignorant of the literature would make such a statement. (or a liar; I am giving you the benefit of the doubt).
In all the other emergent properties you’ve mentioned, we can understand in principle why the property arose. Saying “it’s emergent” with respect to subjective self-awareness is like saying “it’s magic” because there is no way in principle to explain why the mental results from the physical. The gulf is unbridgeable on materialist premises.
@WJM#320
Do you have a criticism of what I actually wrote? Note that I’m referring to explanatory theories about how to solve problems.
Another concrete example of emergence is the universality of universal Turing machines that emerged from a specific repertoire of computations. When Babbage designed his Difference Engine, he wasn’t trying to build a UTM. He was trying to build a machine that could perform a specific set of calculations that humans already performed, but do so more quickly and with significantly less errors. However, this resulted in an even better problem to solve: any time he wanted to perform a different calculation, he need to set all the gears and cogs specifically for that problem, which was slow and was prone to error.
With this new problem to solve, Babbage designed the Analytic Engine, which was also mechanical in nature, and would have read and write the settings of those gears to punch cards. In doing so he stumbled upon the principle of computation. However, neither the Difference or Analytic Engine was actually produced due to funding and personality issues.
While Babbage realized his work represented important progress, this leap to universality wasn’t sufficiently understood until over 100 years latter when Alan Turing formulated the principle of Turing completeness.
Furthermore, despite being built out cogs and gears, Babbage’s Analytic Engine would be capable of running the same version of iOS 8, running on my smart phone nearly 180 years later, in principle, using emulation. That’s what is meant by universal Turing Machine. However, this would be impractical due to the number of punch card swaps required to emulate the amount of RAM and SSD storage available on even the first Gen iPhone, in practice.
So, we have the law of computation, which is a ridged law that refers to emergent properties that arise from physical transformations of matter. This is not to say there are not explanatory content to these laws, but complexity about atoms that happen to be present resolves into higher-level of simplicity.
Earth to evolutionists- The only way you can say Darwinian evolution is the only evolution is by demonstrating that the origin of life is reducible to physics and chemistry. If the OoL = intelligent design then we would infer organisms were designed to evolve and evolved by design.
And this is the main reason that you have nothing. Heck you can’t even explain biological reproduction.
EL says,
I was making a much more ordinary point that the environment in which a population inhabits itself changes as a result of the evolving population(s) it contains.
I say,
Yes and in your view the environment is part of the search in question is it not?
you say,
In other words causality runs from part to whole and back again – from gene to population and back to gene.
I say,
You need to establish how in a step by step process a gene becomes a population.
At what point in the process of evolution does this metamorphosis occur and what is the materialistic mechanism that is capable of this transition.
you say,
And I think you also pinpoint a real problem with the “target” terminology. The only “target” in evolutionary systems is the “target” of reproducing.
I say,
Exactly, evolution is proffered as an explanation for things “targets” that it is not searching for.
Things from biological structures to consciousness.
The probability that any process will produce an output that it is not targeting is the same as random chance.
That is the point of the paper
peace
Joe wrote:
Huh? First, why would I say that it’s “the only”? I’m not even sure what you mean by that. Nor have you addressed the previous comments directed at how ID is not anti-evoliuton.
Second, I’ve pointed to a new mode of explanation, found in constructor theory. Do you haven any criticisms of it, other than asserting all explanations must be reductionist in nature?
Specially, that assumption is philosophical, not scientific. And, if you think otherwise, that’s scientism.
Joe wrote:
Yes, Joe. If all scientific explanations must be reductionist in nature, then we “have nothing”. But, again, that includes the implicit philosophical claim that all scientific explanations must be reductionist in nature.
What empirical evidence do you have to this effect?
EL says,
Where consciousness comes in, in my view, is that it’s a pretty useful capacity to have, if you can get it. So the evolution of features that subserve consciousness will tend to confer a selective advantage.
I say,
Opinions are like bellybuttons everyone has them. The fact is that the overwhelming majority of organisms get along swimmingly with out consciousness.
In the scheme of things consciousnesses has no more demonstrated utility than body fur and probably much less.
I can only know for certain that one organism in the entire universe is conscious that would be me. At least I can directly observe body hair on my fellow mammals.
peace
Barry wrote
Not having all the details (and we have a lot) is not the same as not having an explanation as to how the system works in practice. We have, as I have said, some established principles. In incomplete theory is still a theory, especially if parts of it are confirmed empirically.
You have misread me. I did not say we can’t define it. I said there was controversy over the definition. I am on the side of those who say we can have a working operational definition, but for those who do not accept that this is possible (e.g. Chalmers) then no testing of any hypothesis is possible. In other words, there is confusion, but it is confusion in the field. Unless we can agree on a problem statement, we won’t be able to agree on whether the problem is tractable or not. I think it is, but others don’t. You may be one of them. However, I do think that Edelman and Tononi make a good job of laying out the issues, and their neuroscience is sound.
No. I am entirely in agreement with you that consciousness exists. So do the vast majority of people working in the field (I don’t actually know of anyone who denies it). But people define it differently, and the definition matters.
I have cited you literature that does not propose “it’s emergent” as an explanation, but instead proposes a detailed neuroscientific account. If you can cite me literature that does merely say “it’s emergent” and expects people to accept that as an explanation, feel free.
Right. So “emergent” as you rightly say, is not an explanation itself. It simply a term we use to describe the properties of a system – a class of explanation, if you like, but not an explanation. What we need, as you say, is to understand, in principle, how the property arose.
Well, I disagree. I think it is perfectly possible; I’ve outlined very briefly what I think the principle is, and I’ve given you literature that proposes it in much more depth and detail.
But you do not support this assertion. Your argument indeed seems circular: emergent properties can be explained if they can be explained but not if they can’t.
Popperian- There wasn’t anything to address in your response to ID is not anti-evolution. You obviously didn’t think things through. And your “response” to my latest post proves that you have no idea.
Elizabeth:
It is all speculation, pure and simple. I say that because it is all untestable and therefor not science.
Pop:
Nope, just that responses will occur. Just as not all students give all the same answers so it would be with life. Not everyone would create the same mutation as VARIATION is still key.
fifthmonarchyman says:
They also get along swimmingly without wings, but that doesn’t mean that wings aren’t selectively advantageous.
And I think you have put your finger on the nub of the problem: people think of consciousness as something irrelevant to cognitive function – hence the notion of “philosophical zombies”. If make what I consider the philosophical error of regarding philosophical zombies as a coherent concept, then we must conclude that there is something useless about consciousness, but is a kind of free add on that just makes things hurt when otherwise there’d be “no-one at home”.
In my view, consciousness is not a useless add on, but rather intrinsic to our perception, action and cognition. When someone is “unconscious” the are not conscious OF anything. An entity “like us” not conscious of anything would not be able to function, just as an unconscious person has requires heavy nursing to survive. In other words, the idea that an entity identical to ourselves in terms of behavour and cognitive capacity would not be conscious is to me, an oxymoron. Barry will take this as an admission that I am pretending that consciousness does not exist. My counter-argument is that I am doing the reverse – I am recognising that consciousness not only exists, but consists of the very capacity that enables us to think and behave like people: our ability to be conscious of: other people; hazards; ourselves; our own intentions; the intentions of others; the feelings of others; our options for actions; our past actions; the world; ideas; etc.
And empirical evidence supports this: if parts of our CNS are damaged, we can lose the capacity to be conscious of some, or all, of these things, and become detectably different. So we know a lot about the mechanisms that subserve the capacity for consciousness.
So unlike you, I not only know that I myself am conscious, I know (or at least have very good evidence) that you are too.
Elizabeth Liddle:
Elizabeth drives yet another nail into the coffin of evolutionary algorithms.
Far from being the nail, Mung, it seems like you might have finally got the point!
The populations in computer evolutionary algorithms have exactly the same “goal” as biological ones; namely to reproduce.
The designer of the computer system, however, may have a quite different goal – to solve her problem. So she sets up the fitness function so that the best-reproducing virtual critters will be the ones that solve her problem.
But that’s not the goal of the critters. All they are doing is trying to reproduce as best they can within the constraints of the environment she’s fiendishly designed for them.
I’d be a horrid epistemologist to allow that you could get at my experience of myself experiencing — not a phenomenon — by amassing epiphenomena. I don’t fear that I’ll shrivel up and blow away if I acknowledge that science doesn’t apply to everything real to me.
Not that anyone cares… Active information has been defined three different ways. Has it ever been measured on a nontrivial “search”?
Ever notice how two evolutionists can argue contrary propositions about evolution in the same thread and not seem the least bit fazed by it?
Evo 1: Evolution is not a search.
Evo 2: Evolution is a search.
What’s the point of arguing about active information in such a context? Anyone?
How can evolution possibly qualify as a scientific theory when it’s proponents can’t even agree on something so fundamental?
Mung,
Pick me. I know what I’m talking about. And you know I do.
No Elizabeth. The purpose of “reproduction” in EA’s is to provide fodder for the death algorithm. The purpose of the death algorithm is to kill off the “genomic sequences” that fail to track toward the target in an acceptable manner.
If the goal was reproduction then any genome sequence would be just as good as any other because they all reproduce.
Well, I’ll leave you to think about that, Mung.
EL, AS et al,
I suggest you study the case of the assassination of Abraham Lincoln and the complicity of Mary Surratt et al (Video: http://www.history.com/topics/.....assination ), to see how fast and how nastily things can get out of control when you cosset extremists; and, how implicated you can become without probably meaning to be. Just consider if something untoward happens to any member of my family due to what looks like on the ground stalking now; after, you have lent the aid and comfort to a lunatic fringe for years. I think you don’t realise the fire you are playing with, but thirty years ago I had to deal up close and personal with nihilistic agit-prop radicals and what they can do, how fast and how far it can go. Thankfully Harmon Barracks Paramilitaries fired off the full auto volleys of blanks overhead of the protesters blocking the main military relief road into Kingston in case of things getting out of control.
Not one in a hundred of the students realised then or later what they were doing.
But the manipulators did. In fact, they wanted to trigger an uprising fuelled by rage over dead students as an echo of what had happened in Haiti just before. (I will never forget the hotheaded young student blurting out something in a student meeting and a Communist Lecturer — how he was in a student meeting God only knows — literally boxing him on and then dragging him out by his ear from the meeting room. And STILL many students failed to understand what was going on. Madam, I am coming back from where I pray to God you will never have to go, for if it goes there; there will be blood guilt to deal with on a clan basis. That is what is on the table now. Why didn’t you listen when I warned you years ago?)
KF
PS: If you don’t remember, I suggest you read and ponder very carefully what you did in the context of this comment in a certain thread that was based on watching that ugly vampire clergyman in a graveyard of apparently US military dead smear video and your reaction to it from the very next comment onwards — 10 Elizabeth Liddle January 28, 2012 at 5:54 am — that from your failure to remember now means that you never bothered to watch the video before trying to smugly put down and so played the enabler for an ugly slander; and then madam please reflect very, very carefully on how it has lent cover to what is going on now. (And no I am not going to give you those links, but you had better believe UD’s leadership are in possession of what the lunatic fringe you have enabled for years has been trying to do to me and my family.)
PPS: Those who think this is a derailing of what they imagine is an academic discussion over sipped cups of tea in a Faculty room, please notice the utter unresponsiveness of the principals above to correction of their strawman tactic talking points. And someone else will be well advised to notice how I — not Marks and Dembski, deal with S4S, the blind attempt to find a golden search in the power set of the original config space, as searches are samples or subsets of the set of possibilities. Deal with what is on the table, not what you set up as a strawman. What is going on here is an agit-prop push, based on a one two punch that exploits our sense of politeness so that we disconnect the ugly slander and stalking from the genteel enablers. Also, someone else should know that enabling behaviour does not become illegal, until/unless something explodes nastily. Which, I pray God does not happen.
Elizabeth:
LoL! They are given that ability. The purpose of reproduction is to get something that is closer to the solution.
KF,
Just an onlooker here, but the notion that anyone posting in this thread is coordinating with on-the-ground elements in your country, or has timed their return to UD to coincide with the harrassment you describe experiencing, is absurd.
Does anyone here, ID supporter or not, disagree?
I wrote:
Joe wrote:
Except, you’re not actually disagreeing with me. Specifically, you wrote.
However, this still implies the knowledge of what variations would result in the right proteins that would result in just the right features, across all of those variations that will occur.
Again, if this knowledge was present at outset, did the most simple organism contain the knowledge describing the entire gamut of variations for every organism that would eventually evolve, in every environment, including the most complex that exist today?
To use an example, was the knowledge for each variation response to a corresponding environmental setting that will eventually result in say, dolphins, present in oh, bacteria, at the outset?
And, if it wasn’t present at the outset in organism, then why those variations, rather than some other variations? Was it present in the laws of physics at the outset instead? But that would be evolution under design-laws as indicated in the paper I referenced.
However, if there is some other option, then please enlighten me. Let me guess, that’s just the way some designer intended it to turn out?
Elizabeth Liddle writes:
Michael Graziano has expressed some doubt.
Pop:
Maybe, so what?
Is that required?
Bacteria are stuck at being bacteria. They will never be anything else but bacteria or dead.
The laws of physics do not explain biological reproduction. They do not and cannot explain the genetic code.
Mung,
I know you understand that if I tell you to search some space, and I say nothing about what to search for, then you recognize the absurdity of my use of “search.” But do you understand that there’s no input to the “search” of DEM to indicate what to seek? If you think I’m wrong, then you have to show me how the “search” depends on the target, not merely quote the paper, and put instances of the term “search” in boldface.
The search is conducted by the human (or whatever) that selects and initiates the “search” process in order to generate an element of the target event. Active information indicates how well the human did in selecting the “search.”
When Dembski insists on treating biological evolution as evolutionary search, he’s begging the question of whether an event that has happened is the outcome of an entity that formed a process in order to make the event happen.
daveS,
I think you should shut up unless you’ve walked in his shoes.
Treating evolution as a search is giving it something, something that it doesn’t have nor deserve. You evos should be thankful for that as your approach proves that unguided evolution is impotent.
Simon
Yes indeed. I’ve made the exact same argument here in the past. It never ceases to amaze my how I can point out the blatantly obvious to people and they will reject it.
Now take Elizabeth for example. She likes to think of evolutionary algorithms and the like as a search (when it suits her) but then will turn right around and claim that they are not searching for anything. That they have no target(s).
I can’t tell you the countless hours I’ve spent here demonstrating that EA’s are search algorithms and that to deny that they search for something (call it a target) is the height of absurdity.
[Of course, search for is teleological language indicating purpose.]
OK, Mung, answer this: in an evolutionary computer model, let’s say one designed to optimise antenna design (because we know that one works):
1. Who, or what, is doing the searching?
2. What is the target?
3. Who knows what the target is before the search?
Mung, thank you. Those who have never been where I have been from my youth on, don’t have a clue as to how bad things can get how fast. They imagine, no, signs of cyberstalking are just commentary (that those IDIots we despise deserve anyway) and slander is excused as free comment. Now, it reaches signs of on the ground stalking, and still the denial obtains and there are repeated attempts to play Hitler’s favourite agitprop card, turnabout and blame the victim, it is he who must be in the wrong or paranoid-mad. I will give just one slice of a cake: 28 years ago, many were still in denial not only after the Communist Lecturer dragged the hothead blurter I already mentioned out of the meeting of the Guild, but they were utterly unable to realise the military threat they later posed by blocking Old Hope Road at Papine in front of what is now U.Tech, provoking a sharp reaction as described from the Harmon Barracks paramilitaries. Less than 20 years before that, a student march triggered major rioting in Kingston and led to expulsion from Jamaica of Walter Rodney, a Guyanese uni lecturer who was also a Communist and a decade later would be assassinated in his homeland through a bomb in a walkie talkie, obviously by an intel op. (I should mention, that of all things, the Police intel unit had me down as a radical — Marxist — student leader, rather than one of their chief opponents! Which meant I was in deeper danger than I realised at the time. Another long story. Let’s just say that every significant person or connected person had an intel file that was kept up to date by watch officers who too often were not the smartest of people. I obviously was both . . . ) Today, after pondering, I was led to share above the story of Lincoln’s assassination and how Mary Surratt found herself caught up in things I doubt she realised the dangers of. Enabling, as I said, is not illegal until things blow up nastily, then you are in deep turbulent waters swimming with sharks. People always seem to think that the warning in Plato’s The Laws Bk X is meaningless. But, after today, they cannot ever say that they were not warned on the fires they are playing with, not just in my case but all over our civilisation. KF
Simon:
In which of the DEM papers do they treat biological evolution as evolutionary search?
By the way, now you’re confusing me. I thought you sided with AS that evolution is not a search. Perhaps I just misunderstood you:
If evolution is not a search then “evolutionary search” must be an oxymoron.
Elizabeth, your questions are quite misguided. They are nonsense questions. However, they absolutely reveal the truth of what I said, so they are not completely without merit.
Let us once again start from the fundamentals:
Wikipedia:
The wiki article features your antenna problem, if that helps you.
Elizabeth:
The programmer, and by extension, the program.
kairosfocus, your attitude and behavior are deplorable.
Mung:
We were fine up to this point:
The essential reason that there’s “no free lunch” for the search practitioner (human I referred to) is that the algorithm is utterly uninformed. It begins with no information, and it gains no information about the target as it runs. If information has anything at all to do with the performance of the algorithm, it is prior information of the target that the practitioner exploits in selection of the algorithm. Note that I said if. A fundamental error, I think, in the approach of DEM is that they equate the performance of the algorithm with prior information of the practitioner. If you reread the definition of active information you quoted, you’ll see signs of circularity. I’m open to arguments that the circularity is only apparent, not real.
And I’m emphasizing that what DEM call “search” (following convention in computational problem-solving) actually has no intrinsic purpose. It’s just a biased process for selecting an element of the space Omega. The actual search is the overall process of an entity selecting a process to serve as a proxy in (tool for) generating the target event. My characterization is in line with DEM:
The “requires” is what I disagree with. They’ve shown that the higher the active information, the lower the probability that the “search” was selected randomly.
Search. Targets.
TB: Turnabout and blame the victim. FYI, I am WARNING EL against what sort of things she is/has been getting tangled up with. I am also laying out what is going on sufficient for those willing to take a warning. Stalkers are serious things to deal with on the web much less — now likely — on the ground. You just pray you never have to deal with such. KF
KF,
In 172 you specifically referred to the timing of another poster’s resurfacing at UD. That’s not a warning. You are suggesting deliberate coordination here.
Mung:
The NFL theorems establish that Goldberg was wrong. I have only the first edition (1988?) of his book. What’s the year for your edition?
[Edit: Googling your quote, I get a hit only for the 1989 edition. NFL came in 1995.]
kairosfocus,
Matthew 7:3-5 New International Version (NIV)
3 Why do you look at the speck of sawdust in your brother’s eye and pay no attention to the plank in your own eye? 4 How can you say to your brother, ‘Let me take the speck out of your eye,’ when all the time there is a plank in your own eye? 5 You hypocrite, first take the plank out of your own eye, and then you will see clearly to remove the speck from your brother’s eye.
mung writes:
It might help if Kairosfocus either shut up or clarified his innuendos against Elzabeth Liddle and, I think, me, as far as it is possible to tell from his unparagraphed rants. He is smearing Ms Liddle without the least pretext. Whether it is a ploy because he is embarrassed at being unable to address the topic of the post I don’t know. What this says for apparently influencial contributors to this blog I don’t need to point out. The blog owner is apparently comfortable to let this continue. Fair enough. That it reflects badly on the whole movement is not my business so carry on.
KF,
It’s OT, but somebody has to say it. You owe Dr. Liddle an apology for dragging her name into your persecution fantasies on a public forum. If it’s something you can’t control, you should seek professional help. Your friends here would do you a much better service if they did something to restrain your outbursts instead of tolerating or encouraging them. They should advise you to take a little time off, and apologise on your behalf if you are unable to do so yourself.
Simon, afiak there’s only been one edition. Mine is from the 29th printing, July 2009.
Continuing to take a stand against absurdity and in favor of the simple logical proposition that a search, in order to be a search, must be a search for something:
Further:
fn[1]: Pearl, Judea (1983). Heuristics: Intelligent Search Strategies for Computer Problem Solving.
heh.
Mung
Can I ask, if you think evolutionary processes are a search, who is doing the looking and what are they searching for?
Evolutionary processes would be mostly built-in responses to environmental cues- Spetner 1997. Organisms would be in control of the changes, either by choice or involuntarily through their programming. As with the immune system they are actively searching for solutions by changing pieces of the puzzle.
Over on TSZ Lizzie said:
It’s called parsimony, Lizzie. See also Four Rules of Scientific Reasoning from Principia Mathematica by Isaac Newton.
It is all about knowledge of cause and effect relationships.
KF, as I am concerned for your well being, especially if what you say is true, I took some time to investigate your claims. Your name is well known here so I Googled it and your claim about tort and parliamentary immunity. All I could find is an article authored by you complaining that your name was brought up in parliament by the opposition questioning some sole source contracts that were awarded by the government to you. I hate to break the news to you, but that is the purpose of opposition in a democracy. I am not questioning the ethical validity of these sole source contracts, but government contracts are in the public domain. If they can’t stand up to scrutiny they should be questioned.
I agree with DP. You have repeatedly made some very serious accusations against one of the commenters here who does not cowardly hide behind an avatar. As such these accusations are libellous unless you provide evidence to support them. Since you refuse to do so, I strongly urge you to apologize.
Aurelio Smith:
You claim that evolution is not a search. Now you’ve expanded that to include all evolutionary processes? Could you be more specific? What constitutes an evolutionary process?
How about the immune system. Does the immune system use an evolutionary process?
http://en.wikipedia.org/wiki/Immune_system
Simon @368.
You’ve just reminded me of another common battle I’ve had to fight here at UD against it’s opponents.
IOW. Intelligent Design.
EL says,
They also get along swimmingly without wings, but that doesn’t mean that wings aren’t selectively advantageous.
I say,
Sometimes wings are advantageous sometimes not. Flightless birds are a testament to that.
As has been conceded by everyone here Evolution is not targeting wings.
The probability that an evolutionary algorithm will yield wings (or consciousness) is no better than any ole random search.
That is the point.
If evolutionary algorithms do not increase the likelihood of wings then it is fallacious to offer evolution as an explanation for the existence of wings (or consciousness).
It’s pretty simple
you say,
So unlike you, I not only know that I myself am conscious, I know (or at least have very good evidence) that you are too.
I say,
I think you are misunderstanding me. I agree that we have good evidence that those around us are conscious. I only claim that we can’t be certain they are.
The problem is any evidence good or not must incorporated into our worldview.
For instance I have good evidence for life after death but if I was a materialist I would have no way to incorporate this evidence because I know of no materiel mechanism that could possibly yield life after death.
Can you explain how given materialism that consciousness could possibly arise from particles in motion?
Remember “It had to emerge” is not an explanation
peace
EL @ 336:
EL, just because you can spill sewage into a combox does not mean you should. I called your bluff. As usual, when caught, instead of retracting you double down.
Here is a principle you should write down: Spewing sewage into a combox over and over does not turn it into Evian.
There is no theory that even begins to account for how physical things like chemicals can result in mental things like subjective self awareness. You say there is. I have asked you to summarize that theory. You steadfastly refuse to do so. Why? Because you cannot summarize a theory that does not exist. Show me wrong if you can. Prediction: More sewage or silence.
Joe:
Gee Joe, it’s your theory. That’s why I’m asking you. Avoidance much?
It’s unclear why someone arguing their theory isn’t anti-evolution keeps avoiding questions design to make their theory more clear.
Maybe your theory isn’t anti-evolution? Why should I care?
I wrote:
Joe:
Again, the question is, under your theory, why is that the case? This leads me back to the same question. Is some knowledge present at the outset which indicates what variations should occur under those conditions? In this case, the knowledge of which variations could occur that would cause bacteria to remain bacteria. Or is that knowledge is the laws of physics?
Or perhaps you think it’s none of the above? By all means, feel free to “fill in the blank.”
I won’t be holding my breath.
Joe:
Again, implicit in that statement is the philosophical view that explanations should be reductionist in nature. You have yet to respond to this. At all.
Mung:
You understand that screwdrivers do not themselves drive screws. Why is it difficult to accept that black-box search algorithms like GAs do not themselves search? In both cases, the name of the tool reflects the use to which it is put. That is all.
The various forms of evolutionary computation are metaheuristics, not heuristics. It’s an important distinction.
DEM tell us straight-out that the “search” Delta(S) is an Omega-valued random variable. The target is just a subset of Omega, which is to say an event. The distribution of a random variable does not depend on the event we’re interested in. If you know what a random variable is, then you know it’s ludicrous to say that it searches for an event. If you don’t know what a random variable is, then you should stop trying to tell us what’s what.
Some very bright people have been confused by what’s confusing you now. David Goldberg was one of them. (He also emphasized the Schema Theorem of his advisor John Holland, which turned out to be wrong.) The only good option is to accept your error, and try to learn from it. Trust me, I’ve been through it.
Popp:
They have to be reduced to a cause capable of explaining what is being investigated. Materialism requires the reduction to physics and chemistry, ie matter, energy, their interactions and what emerges from that. I tend to contrast ID with alleged alternatives.
See “Not By Chance” Spetner 1997
I covered all of that in Intelligent Design is NOT anti-evolution
Then there is “Not By Chance”
No magic allowed. For example there aren’t any parts on a bicycle that we could modify to get a motorcycle via descent with modification starting with a bicycle. It’s almost a total redesign.
Please do.
Lizzie,
The book doesn’t help you at all, it’s a classic example of the good old cum hoc ergo propter hoc— ‘correlation is causation fallacy’. Evidence is provided suggestive of consciousness being *associated* with interconnected regions of the brain. And from this, Edelman and Tononi conclude that consciousness *arises* from the brain.
IOW no mechanism that describes how to get from chemicals to consciousness, but a questionable cause logical fallacy instead. As for the misleading book title—“A Universe Of Consciousness: How Matter Becomes Imagination”—, well that’s in line with a long standing tradition amongst materialists, isn’t it?
Simon:
Why is it difficult to accept that black-box search algorithms like GAs trace back to their programmers who designed it as a search heuristic?
No one is saying the GAs are conscious. They do as they are programmed to do. The antennae GA will never spit out “Methinks it is like a weasel” as a solution.
The confusion is all yours. Now go back to your swing set and play with the other children.
Barry: “EL, just because you can spill sewage into a combox does not mean you should. I called your bluff. As usual, when caught, instead of retracting you double down.”
Barry, I have been following the discussion between yourself and EL. I will be the first to admit that I do not understand the complexities as well as you obviously do, but I think that EL has explained herself quite well. I don’t see how calling her responses “sewage” benefits anybody. You have repeatedly dismissed her comments as bluffs or sewage but have not provided any justifications for classifying them as such. As a recent observer at UD I must be honest and let you know that, from the outside, EL is presenting a better argument.
Box says,
Evidence is provided suggestive of consciousness being *associated* with interconnected regions of the brain. And from this, Edelman and Tononi conclude that consciousness *arises* from the brain.
I say,
This is a common fallacy among our apposition. Evidence is provided that biological structures are *associated* with a trial-and-feedback process (evolution) and our friends conclude that this trial-and-feedback process can explain the arrival of biological structures.
I only wish they would use their heads.
peace
Joe doesn’t know what a random variable is.
Next up?
Reminder: See p. 12 (numbered 37) of Dembski, Ewert, and Marks, “A General Theory of Information Cost in Successful Search,” which Dembski has identified as the authoritative reference.
*sigh*
Variables are neither random nor non-random.
Your turn Simon.
Hey unwilling participant,
What part of EL’s argument do you find to be convincing?
Please be specific. Do you honestly believe that she has provided the basics of a theory that can explain how matter can produce consciousness?
Do you understand promissory notes are not sufficient unless it can be demonstrated that such a thing is even possible?
peace
Simon spews nonsense. Simon doesn’t know that the alleged random variable is programmed to occur and is directed towards the goal.
Experience- that appears to be all she does- bluff, equivocate and refuse to grasp what is being debated.
unwilling participant @ 387:
Which says a lot more about you than EL’s argument. Let me clue you in. Mere assertion is not an argument. EL claims there is some theory out there that explains how physical things like the chemicals in your brain result in mental things like your subjective self consciousness. The truth is that no such theory exists. EL throws out some names and says they have written books explaining the theory. They have not. How can we be sure? I have have asked EL to summarize their explanation and she refuses to do so. Why? Because she cannot summarize an explanation that does not exist.
Now, back to your comment. You say EL has a better argument when she has no argument whatsoever. How can we account for this bizarre assertion on your part? Like almost every materialist I have ever met, evidence and logic are not your strong point. Your position is based on grit your teeth in the face of the facts blind faith. And for such as you, EL’s non-argument is better than an actual argument that challenges your faith commitments.
Of course, it would be easy to prove me wrong. If you think EL has made such a fine argument, you should have no problem summarizing it for us. Be my guest.
unwilling participant,
Why not go all the way and tell us what that argument is? We haven’t got a clue.
Mung,
I’m genuinely stunned. It’s one thing not to have had an introductory course in probability. It’s quite another to smart off without Googling first.
random variable
I had pointed you to the page on which DEM identify the search with a random variable. You were sneering at the leading ID theorists.
fifthmonarchyman: Sometimes wings are advantageous sometimes not. Flightless birds are a testament to that.
Evolutionary lineages tend to spread out into unoccupied niches. If there is a niche for flighted aminotes, then some lineages may move into that niche, while other lineages will continue to occupy the flightless niche.
I wrote:
Joe:
Again, what is your justification for this assumption? Is it empirically evident?
No, you’re confusing materialism with a particular philosophy of science. Namely, the idea that there is only one mode of explanation in science: reductionism. Are you saying I have to be a dualist to solve the problem of making tea?
Joe:
It’s a simple question. In fact, I’ve even given you two summaries. Why can’t you provide a summary?
Joe:
Just skimmed that. Didn’t see anything new regarding how cells know what variations are acceptable that was not already in your comment.
Your guest post:
Again, if the cell is going to respond to environmental cues, it would seem that it would need to contain the knowledge of what responses to perform given the right cues for the right organism in the right phase of evolution. This is the program, or recipe, that Von Neuman referred to with is programmable constructor. Was that knowledge there at the outset? Was all the knowledge for those responses present in a bacterium for all future organisms that will evolve from it? Or is it present externally in design laws of physics?
And, again, if none of the above, then please enlighten us. Let me guess. Those variations occurred because the designer intended them to occur, rather than some other variations?
There you go UP. Three of us have independently arrived at the same challenge. You think EL’s argument is so good, kindly summarize it for us.
And if you can’t, you should examine what led you to say not only that it exists but that it is superior. I doubt that you will, being a true believer and all.
Simon, it was over your head. Whatever. I don’t trust the Google search algorithm. I don’t understand how I could possibly trust my search for what “random variable” means to a computer. In fact, I looked it up in a book on probability. First I searched the index. Then I searched for the indicated page number.
Popperian- It’s called science- science requires an explanation with a cause that is capable of explaining what we are investigating. Materialism is a particular philosophy of science that posits what I posted.
What variations are acceptable? The variations that help. Look at the immune system- it responds to the environment.
In 1967 there was a release of 100 identical finches and within 17 years they had diversified. Darwin thought it would take millions. The variations were induced by environmental cues.
That you can ask such a question after what I posted proves that you are proudly clueless.
SimonLeberge,
Can a computer perform a search? I would like to understand your thinking on that. I don’t want to misrepresent you.
EL: I wanted to comment on your statement that evolutionary algorithms can solve problems no human agent could. This is not true at all. Human designers do what evolutionary algorithms do, and start with populations of working designs, vary properties of those designs, and iteratively select designs that show the most improvement. A key difference is that the human can often more intelligently select useful variations than by random chance. But it’s still the same concept.
By comparison there are whole classes of problems evolutionary algorithms can’t even pretend to solve, namely any problem that requires top down design. Or any problem involving irreducible complexity. An example is give an evolutionary algorithm a box of car parts and try to have it piece them together into a functional car. Or have an evolutionary algorithm try to design a skyscraper that doesn’t topple starting from a house.
I am a computer scientist — could an evolutionary algorithm make useful modifications to a piece of general purpose software? I.e. not some toy example like Avida, but a real piece of software with over a million lines of code. Any change to such a program requires coordinated changes, the definition of irreducible complexity. If you make a mistake, it’s generally fatal, and detecting the failure case you’ve introduced takes orders of magnitude more time than making a change. A computer program modifying a computer program would instantly destroy it in an unrecoverable fashion. Real world cases where EAs are applicable always involve a tiny amount of code in a heavily constrained environment. The natural world is the opposite of that. Living organisms contain a huge amount of code, and the environment is highly unconstrained.
Humans use abstract reasoning to organize programs in a top down fashion to make the problem tractable, but machines aren’t capable of such reasoning. I know for a fact there will never be a computer program that can write code (take over my job).
Zac says,
Evolutionary lineages tend to spread out into unoccupied niches. If there is a niche for flighted aminotes, then some lineages may move into that niche, while other lineages will continue to occupy the flightless niche.
I say,
Just what I said
When you are not throwing out off topic red hearings you are simply rephrasing and regurgitating the other side’s comments.
Do you even have the ability to offer something that is both original and on topic??
Peace
PS
In the interest of civility I’m going to do my best to ignore Zac for awhile. I hope everyone understands.
Barry: “There you go UP. Three of us have independently arrived at the same challenge. You think EL’s argument is so good, kindly summarize it for us.”
Maybe using the term “better argument” is an overly generous one. A more accurate term would be “only argument”. I have yet to see an argument from you. Dismissing someone’s arguments as bluff and sewage is not an argument, it is just arrogant and rude. But for some, that is all they are capable of.
Barry wrote:
As you regard any attempt I make as either “sewage” or “bluff” there is no point my even attempting to respond, Barry. You have decided that any argument I can offer is “sewage”, because you have decided, a priori, that there is no such argument, and that any supporting literature I cite is a “bluff”.
UDEditors: No, we did not decide that any argument you made was sewage. You said you presented an argument and you did not. You evaded, dissembled and distracted. We are not surprised. That is what you always do. We called your literature bluff, and instead of fessing up you doubled down, which is also what you usually do. We are baffled that you think we’ll let you get away with that.
All I can do at this point is to say that I myself am persuaded by the arguments in that literature that the reason we are conscious is that we have brains, . . .
UDEditors: The “argument” is that we are conscious because we have brains? That is absurd on its face. Yes, we have brains; yes we are subjectively self aware. How does one cause the other? That is the issue. Your evasion of the issue has been obvious for all to see.
. . . and that the mechanisms in the neuroscience literature widely agreed to account for that consciousness, . . .
UDEditors: No such mechanism has been described. You know this; I know this. Why do you keep insisting on saying obviously untrue things?
and to explain why brain injury results in altered consciousness, and which I summarised in principle, are well-founded in empirical science.
If I weren’t so persuaded I wouldn’t be making the case.
UDEditors: No, if your faith commitments were not so strong you would not be asserting that which is patently false. Your brass bound adherence to materialist orthodoxy in the teeth of the evidence would make an Appalachian snake handler blush.
You are clearly not so persuaded, so we must agree to differ.
UDEditors: We agree to differ because you have presented no evidence, no argument, no mechanism. You have presented nothing but your faith claims. And yes, we have declined to adopt your faith.
UP says,
A more accurate term would be “only argument”. I have yet to see an argument from you
I say,
apparently you don’t understand what is going on here.
Let me spell it out for you
According to EL’s worldview matter is the ultimate reality and consciousness is secondary therefore she owes us an mechanism by which the primary reality can yield the secondary phenomena.
On the other hand Barry is not claiming that consciousness is a secondary dependent phenomena but ultimate in it’s own right therefore he is not obliged to explain how it can possibly emerge from matter.
This should have been obvious to anyone paying attention to the “arguments” I’m not sure how you missed it.
peace
FM: “According to EL’s worldview matter is the ultimate reality and consciousness is secondary therefore she owes us an mechanism by which the primary reality can yield the secondary phenomena.”
And she referenced several people who have, supposedly, proposed possible scenarios. I have not read these so I cannot comment on them. But I wager that Barry hasn’t either. Otherwise he could present a cogent argument refuting them. Accusing EL of bluffing and spewing sewage is not the act of someone willing to have an honest discussion.
Frankly, I don’t see why some IDist get so emotional over whether consciousness is primary (ultimate) or secondary (emergent). The only thing I can think of is that Barry, in this case, is speaking more from his religious beliefs than from his ID beliefs, which is understandable. But there are also many IDists, such as myself, who are not religious. ID, as a concept, is equally compatible with both a primary or secondary cause of consciousness. Evolution is only consistent with one.
UP @ 409
liar. You don’t think we can spot such an obvious troll?
You were challenged to summarize EL’s “superior” argument. This is how you do so: “she referenced several people who have, supposedly, proposed possible scenarios.” Pathetic.
UDEditor @ 407,
Has fundamentalism permeated the ID supporter camp? Are we in a position now to render judgment without reviewing proposed evidence suggested by the opposition?
I have tried to be only slightly involved in this thread but now I feel that I must say more. As I said before, kairosfocus’s attitude and behavior are deplorable but just as deplorable are the enabling and encouragement of his attitude and behavior by other IDers including Barry Arrington, the “President” of this hate-site. kairosfocus’s rants and accusations in this thread and many others are unsubstantiated, hateful, irrelevant, distractive, libelous, and hypocritical, yet not even one other IDer has asked him for any evidence that explains and supports his numerous hateful accusations, let alone convincing and complete evidence, and that goes to the core of what is wrong with the members of the ID agenda. Unsubstantiated, erroneous assertions and accusations are constantly put forth, automatically accepted, angrily defended, and zealously promoted by IDers. Virtually nothing is questioned, challenged, chastised, or deleted no matter how outrageous it is, as long as it is asserted by another IDer.
Whether it is kairosfocus’s unhinged tirades, the rudeness and crudeness of Joe-Mung-Mapou (Are they the same person?) and other IDers, the spam tsunamis by bornagain77, the TLDR speeches by vjtorley, the constant attacks by all IDers on materialists, atheists, evolutionists, Darwinists, naturalists and other labels that are applied to the opposition (usually inaccurately), the claims by IDers that evolution didn’t and can’t do this or that, the endless repetition of thoroughly refuted claims, or the censorship on this site, ENV and others, ALL of it is just unsubstantiated assertions, pseudo science, self-righteous sermons, religious proselytizing, diversionary tactics, and malicious accusations, and none of it provides any positive, scientific evidence to support what IDers actually believe and are dishonestly trying (unsuccessfully) to hide behind a mask of sciency sounding nonsense, and of course that belief is that a supernatural being they call “God” created and manipulates everything or most things (whichever is convenient for their assertions at the time).
The lack of honesty, integrity, rationality, courage, decency, and self-awareness in IDers never ceases to amaze me. For speaking out I will very likely be banned and then called a coward and other derogatory names for not responding, as that is the typical modus operandi for this site. In a fair fight you IDers don’t have a chance and you know it.
I don’t know how Jon Bartlett feels about how the comments thread has developed from his kind offer to host an OP on “active information”. I am rather disappointed. I wonder, do any ID proponents who haven’t yet said anything share my view?
NetResearchGuy #404,
thank you for your excellent post!
In part this addresses the preservation of homeostasis problem. In post #155 I argue that in an evolutionary search the unlikelihood of preservation of homeostasis needs to be factored in. Elsewhere I have argued that it is no good at all for any organism if evolution finds a new protein without regulation already in place—as you say: “any change to such a program requires coordinated changes”.
This is similar to an attempt to circumvent / ignore the preservation of homeostasis problem.
If they haven’t done so already, I do hope that DEM will find a way to factor in the unlikelihood of preservation of homeostasis. My guess is that the numbers won’t look pretty for (unguided) evolution.
What Jon Bartlett (and other IDers with the authority) could and should have done is quickly delete and prevent all of the off topic garbage that has been spewed by kairosfocus and other IDers, and that would also have prevented the off topic but necessary and legitimate responses from non-IDers. Bartlett obviously has no problem with the destruction of the thread by his fellow travelers. I suspect that he “invited” your post just so that he could watch and enjoy the train wreck.
My comment at 415 is addressed to Aurelio Smith. I apologize, Aurelio, for leaving that out.
#412 truthbringer
I don’t think the ID camp is as bad as you paint it. Over the course of the years I have often wondered why I carry on commenting, but I have also had many interesting and very occasionally fruitful debates. I will take the opportunity to air a few home truths which may result in the end of my commenting!
On the bad side. Debate here has become depressingly negative and repetitive – an unending drip feed of gossip, innuendo and half-truths attacking Darwinists/evolutionists/atheists/scientists/materialists etc. I think this reflects the weakness of the ID argument. The argument is essentially “evolution is wrong therefore ID is right” and the only way to make this case is to attack evolution and those who defend it. More worrying is a streak of paranoiac delusion (irrational fear of a worldwide conspiracy of evolutionary biologists is not yet on the DSM but maybe one day). This is most extreme in KF, but you see it in Denyse’s gossip column and elsewhere. Barry/Joe/Mapou/Mung’s strings of insults are tedious but no different from most internet debating sites and you can just ignore them; buried in the verbal assaults will occasionally be an interesting point.
On the good side. I think the vast majority of ID proponents are sincere. I try not to guess people’s motivations but debate seems to proceed OK on that assumption. I have always found vjtorley and gpuccio to be intelligent, informed and polite (although vj’s contributions are much too long for anyone with a life to lead) and others such as Silver Asiatic and 5MM are polite, prepared to listen, and address the argument. Above all, for me it is great opportunity to interact with a community that is so totally different from my own and I thank those who are willing who to give me that opportunity in a constructive and polite manner.
F/N: I observe that, unacknowledged, the substantial initial claims made by AS are dead.
Dead, because, first, it is immediately plain that active information is directly based on evolutionary algorithmic blind, needle in haystack search challenge. Clipping again from Marks & Dembski’s 2010 paper, opening words of its abstract:
And while one may wish to raise a cloud of talking points regarding the NFL theorems, there is a quite simple and less open to dispute viewpoint. Namely, to start, that a direct flat random blind search on a space of possibilities W, faces odds of success on any one observation of 1/W, so if the scope of search c is such that the needle in haystack search becomes practically hopeless, we can build a yardstick on this. For, next, a blind search is a blindly selected subset (matters not if a dust or a walk or a combination under needle in haystack conditions). The set of subsets for a set of cardinality W is of cardinality 2^W, exponentially larger. So, blind search for a golden search that bypasses the search challenge of a direct search will plausibly be at least as hard as direct search. And because searches — other than the hard to find golden ones — of deeply isolated and rare targets in spaces that exhaust accessible resources to do very small fractional samples are unlikely to find needles in the stack, the result for flat random small sample is as good a yardstick as any other.
(Recall, for 500 bits of configs, the search to space ratio is as a straw to a cubical haystack comparably thick as our galaxy. For 1,000 bits the corresponding stack would dwarf the observed cosmos. And if one thinks coins are unrealistic consider instead a paramagnetic substance of 1,000 atoms in a weak B-field with N up/down possibilities.)
So, we have a basis to identify that if a presented search that is claimed to be blind performs like a golden search, it results from intelligence that has (typically without realising) injected active targetting information. Providing a nice broad continent of well behaved fitness to feed ascent to peaks, or putting down on or next to such an island etc are typical cases. For, in reality, requisites of functionally specific complex interactive organisation and associated information (FSCO/I) to fit with particular wiring diagrams (with small tolerances) confines functional configs to narrow zones T in large spaces W.
So, one may construct a reasonable metric of injected active info, based on the magic leap in performance.
Directly, FSCO/I and linked blind needle in haystack search challenge puts the problem of reaching shorelines of function in the centre of the issue.
And we know the circumstances utterly undermine plausibility of blind search.
This then brings us to the centrality of the causal inference filter per aspect of an object, phenomenon, process etc. AKA the design inference explanatory filter.
When something shows a tightly repeatable, low contingency outcome under similar enough initial conditions, that warrants a conclusion that mechanical necessity is at work. So, absent indication of high contingency, this is the default (it is in principle possible that lucky noise or deliberate action is mimicking, but we usually don’t take that seriously.)
But if high contingency obtains instead, we have two possibilities. Accepting possibility of a false negative, we default to blind chance UNLESS the sort of result is utterly implausible.
That, obtains on signs like FSCO/I which manifest JOINT complexity and specificity setting up a T in W blind needle in haystack search situation. Then, we infer intelligently directed configuration, AKA design.
This is backed up by a trillion-object base of empirical findings and cases that shows its empirical reliability. Design is the only observationally warranted cause of FSCO/I.
Now, all of this has been pointed out over and over again, day by day, year by year.
That is why there is no excuse for the strawman caricature laced argument in the OP. Nor, for the further strawman tactic, zero concession response onward when the errors of the OP were corrected.
But, the talking point drumbeat will go on and on, twisting, caricaturing, evading responsibility, chasing red herrings etc.
Been going on for years.
On the secondary issue of emergence of conscious mind and the like, it remains the case that there is no credible evolutionary materialist account of responsibly free conscious individuality and associated credible rational mind. Nor is this news, J B S Haldane warned on such over eighty years ago:
I predict, the drumbeat of evolutionary materialist and linked radical secularist talking points will go on and on, until things crash as they crashed for the Marxists 25 years ago. And unfortunately, institutional power will be abused in that agenda, as has been going on. It is only when the march of folly sends enough people and institutions over the cliff — and not just designated scapegoats like those IDiots and thrice condemned fundies — that a critical mass will suddenly wake up. But I suspect it will then be too late for the sort of civil liberty we have taken for granted in recent generations.
Signs are already pointing that way. (Think about what folly could bewitch a legislature to set up such laws, and why safeguards failed for years, including why police were acting like that with patently innocent people. Then, tremble for our now increasingly likely future.)
KF
PS,Re TB et al, just for record: Projective turnabouts are to be expected in an agit-prop situation. Enough has been said in warning, in light of a years long situation of enabling behaviour and the sudden — and on a longstanding declaration of non-interest in returning to UD, “interestingly” timed — surfacing and focus in an ongoing context of a smear attack by the attack site fringe. Walking in in such a situation with such a background as though nothing has been going on in circles one is associated with and facilitates with editorial power through hosting a significant site organically connected to the circle of attack sites, itself forces the targets to conclude, 1-2 punch. The generalisation of the attacks that is ongoing is now characteristic of such agendas. Notice, one sided demands for apologies and projection of hate etc once the target defends itself. As in, how dare you hit back first. Nowhere to be found are serious acknowledgements that years of stalking, smearing under pretence of freedom to speak and outing of uninvolved family etc are material concerns; particularly now that trumpeting of remote connexions not accessible online indicates likely on the ground stalking not just cyberstalking. (And, onlookers, the relevant law enforcement civil authorities were contacted years past. Due to the state of cyber law, little can be done before the fact. So, only responsible self-policing by all sides to controversies can restrain the lunatic fringe which we all know is always there. Given groups and enablers who refuse to do that, all we can do is highlight that fact. And if that is enough to bring forth a “new” cloud of demanders for apologies etc, what does that say about the years long enabling of slander, personal attack, outing, stalking and target-painting backed up by a refusal to self-police? As in, there once was a certain apostle who counselled to try 1, 2, 3 times, then mark the insistently disruptive, hostile and destructive, and particularly those who lead and enable. That, too, is in the counsel of the scriptures resorted to manipulatively and twisted out of context above.)
truthbringer the hypocrite- The lack of honesty, integrity, rationality, courage, decency, and self-awareness in ID critics and opponents is amazing. In a fair fight you would lose badly. You would be eviscerated.
Aurelio Smith- Your OP is so full of nonsense and mistakes it make me wonder why anyone would host it here. It must be only to show how desperate our opponents are.
Mark Frank:
What an ignorant thing to say. It’s as if you are totally incapable of learning anything.
It is true that if your position had something then most likely ID would have been a non-starter- so perhaps that bothers you tat your position has nothing. But it is hardly the case that ID is merely an attack on necessity and chance.
ID’s opponents have proven to be ignorant whiners.
Hey Mark Frank,
I appreciate that I made the polite willing to listen group I only wish I would have been in the intelligent and informed group.
After all these years I still can’t get a seat at the cool kid’s table.
UP said,
she referenced several people who have, supposedly, proposed possible scenarios. I have not read these so I cannot comment on them. But I wager that Barry hasn’t either. Otherwise he could present a cogent argument refuting them.
I say,
If I gave you a list of several people who claimed to give possible scenarios where by a square could give rise to a circle would you feel that it would be necessary to study their proposals in depth before pronouncing them to be either “sewage” or “bluff”?
Would you feel it necessary to give a detailed answer to rebut a circle to square argument?
Come on man use your head. Matter and mental are entirely different categories of substance.
It is definitionally impossible for one to yield the other in a step by step algorithmic process.
I’m not sure how something this obvious could have escaped your notice. The fact that it does tells me a lot about the sincerity of your criticism.
peace
5MM #422
Sorry – I didn’t meant to imply that you were not intelligent and well-informed. It is just that I have had many more detailed discussions with vj and gpuccio.
#5MM
You have illustrated my point! VJ is well informed enough to know that this is by no means obvious.Dualism has been rejected by very respectable people at least since Ryle’s Concept of Mind and arguably long before. You may disagree with UP but to claim he/she is obviously wrong and therefore insincere when his/her opinion is widely held by major figures in the field is the equivalent of putting your fingers in your ears.
F/N: Let’s hear DI Fellow, Nancey Pearcey bring this issue right up to date (HT: ENV) in a current book, Finding Truth:
. . . also tellingly highlighting Darwin’s selective skepticism:
If you imagine we are here having a genuine interactive give-take rather than a talking points based agenda push, see if these and previous concerns are genuinely taken up and responded to cogently.
I predict, more of the business as usual agenda push, until things so massively crash and burn that the consequences cannot be denied.
And, my point starts with how an OP like the above could seriously be composed and presented as if it were not a forest of burning strawmen. Then, with how it proceeds in the teeth of correction, multiplied by 1-2 punch agit prop games and more.
Let’s see if at long last my expectation, happily, will be falsified. But, I am not waiting with bated breath.
KF
F/N 2: Just as a reminder, Reppert:
There are no square circles, rocks have no self-aware rationally contemplative dreams (even if refined into computational substrates . . . which, are blindly mechanical and GIGO limited) and you cannot get North by insistently heading due West. All of which have been pointed out repeatedly with good reasons. But, ideology demands otherwise . . .
KF
Barry: “liar. You don’t think we can spot such an obvious troll?
You were challenged to summarize EL’s “superior” argument. This is how you do so: “she referenced several people who have, supposedly, proposed possible scenarios.” Pathetic.”
Is that your response to everyone who questions you? Call them a liar and a troll. Now, who is the pathetic one here?
EL has provided you with several references which you refuse to look at. She has provided you with answers to your relevant questions. Your response is abuse. Again, who is the pathetic one.
Ps, an apology for unjustifiably calling me a liar with no supporting evidence would be appreciated.
Zachriel: Evolutionary lineages tend to spread out into unoccupied niches.
fifthmonarchyman: Just what I said
Then your follow-on statement, that “the probability that an evolutionary algorithm will yield wings (or consciousness) is no better than any ole random search” is false on your own understanding.
tend, regularly or frequently behave in a particular way or have a certain characteristic.
Box: Elsewhere I have argued that it is no good at all for any organism if evolution finds a new protein without regulation already in place—as you say: “any change to such a program requires coordinated changes”.
A simple example is evolution in Lenski’s long-term evolution experiment. There were two potentiating mutations, and a tandem head-to-tail gene duplication. What’s pertinent to your comment is that the duplicated gene was put under the control of a different promoter, for an adjacent gene, rnk. Later testing showed that the new rnk-citT module was sufficient to produce the Cit+ phenotype.
Your claim is that such evolution would require coordinated changes. Well, there you are.
MF said:
That respected and major figures agree to a thing does not make that thing any less foolish or logically absurd.
WJM
That may be true. But it is good reason for inspecting your assumptions and not rejecting any alternative as insincere.
FM: “If I gave you a list of several people who claimed to give possible scenarios where by a square could give rise to a circle would you feel that it would be necessary to study their proposals in depth before pronouncing them to be either “sewage” or “bluff”?”
I would certainly examine at least one of them. To do otherwise would be irresponsible. But we are not talking about something that is a certainty, or as close to one as possible. We are talking about the nature of consciousness. A subject that one side of the argument admits is not settled. Unfortunately it is not the ID side if I can go by the comments here. EL, even though I disagree with her has expressed her view logically and politely. Barry simply responds by calling it bluff and sewage. You don’t have to take my word for it. You don’t even have to understand the subject. Just read the comments and tell me who comes a cross as a pompous arrogant buffoon.
As you seem to be one of the reasonable voices here, I think that when you review the comments you will agree with me.
Yes that is an example of built-in responses to environmental cues.
Mark Frank:
Yet well informed people know that it is obvious.
So, Aurelio, when are you going to start that critical analysis of active information?
Mark Frank:
When is the last time I insulted you Mark? Just wondering.
Joe:
Yes that is an example of built-in responses to environmental cues.
Except all colonies did not evolve the ability even though they started out identical.
OT: Back in Navy boot camp, many moons ago, I would drag my boots while marching in order to create noise. The noise of my doing so was often drowned out by the cries of my mates telling me to shush. It’s as funny now as it ever was.
The way to reduce noise is not to add to it.
SimonLeberge,
Can a computer execute a search algorithm?
Vel- Not all students get the same answers even though they are taught the same material. How many equations do you think can satisfy the answer of 42?
One of the best UD threads in a while.
William J Murray delivers the death blow @ 325
Mung #436
I am being unfair to you and apologise for that. Looking back at your comments you come nowhere close to the other three. I just got the impression of a set of insults but it is more stuff like #104, #105, #106, #108 above (just responding “nonsense” without any explanation) which seems rather pointless and aggressive but is not insulting. For a more direct example:
So all these materialists who claim that morality is subjective are just full of **it.
It is not a big deal. As I said this sort of thing is typical of any internet discussion group. A lot of anti-IDists (probably including myself from time to time) do it. It only seems a bit much when people start lecturing Lizzie about her behaviour when in fact she is rather remarkable in showing respect to opponents and refraining from anything personal.
Other than EL’s unsupported say so, I have no reason to suspect the book contains what she claims it contains, because she has (1)provided no pertinent quotes, and (2)won’t even offer us her summary of the biology-to-consciousness mechanism supposedly described in the book.
If EL is sincere, she is free to provide quotes and summarize the theoretical biology-to-consciousness mechanism for us.
I summarised in 273 and 299.
I can go into more detail if you want, but the key is the re-entrant looping of simulated output of action as input into action selection.
But frankly I’ve had enough of this thread. If you want to continue, I will be at TSZ.
UDEditors: WJM says that EL won’t even offer us her summary of the biology-to-consciousness mechanism supposedly described in the book. EL responds that she provided a summary of the mechanism in 273 and 299. Both of those comments are reproduced below and we invite our readers to read them in detail.
Now, unless providing a “summary of the biology-to-consciousness mechanism” she claims exists means “ruminate about high level specutations without even a nod toward providing even a single detail regarding the mechanism of how one gets from chemicals to consciousness,” EL’s claim to have summarized a mechanism is false.
I see that EL has retreated back to her echo chamber at TSZ with her tail between her legs. EL, come on back when you are ready. But if you post false claims about how the materialist have found the mechanism by which chemicals become subjectively self-aware, expect to be called down again.
Here is 273 in its entirety:
@Box: In my view, yes. But to some extent it’s a philosophical issue – if you accept Chalmer’s formulation of the Hard Problem then no. I don’t buy his formulation. I think it contains a philosophical error. But I’m not enough of a philosopher to be able to articulate just where it is, and I could be wrong! But I think the essence of the answer lies in our capacity simulate the outputs of our actions before we execute them and feedback those outputs as inputs into the action-selecting process. That allows us to both anticipate and remember in what Edelman calls a “remembered present”, in which past and possible futures are integrated.
But that should really be for another thread! This one is about Ewert, Dembski and Mark’s concept of Active Information
Here is 299 in its entirety:
Barry: I do not “admit” that “no such process has been described”. Such a process has been described in all the sources I mentioned, and in many journal papers. In other words, we have a proposed explanation, not merely an assertion that “it’s emergent”, which is what you claimed, and which, I agreed, would not be an explanation. We certainly do not have “the details” – what we have is a explanatory model, and which, like all scientific models, is provisional.
The problem with the explanation, however, is that unlike most topics in science, there is controversy over whether the phenonomenon it seeks to explain, consciousness, can ever be operationally defined, i.e. defined in such a way that its presence or absence can be objectively detected. Without such a definition, no theory of consciousness can be tested. That is why Chalmers described the problem as “Hard” (not merely “hard”).
So the Hard Problem of Consciousness, as formulated by Chalmers, can never be “solved”, and there is no literature that anyone can ever cite that will tell you that it has been. Any explanatory model must be predicated on a different formulation of the problem. So any scientific solution to the problem is only as good as the philosophical formulation it is premised on, and, as I said, that in itself is controversial.
But the issue isn’t (as you claimed) that people have tried to palm off “it’s emergent” as an explanation. Emergent properties abound in scientific models, and nobody that I know of would consider merely labelling a property as “emergent” as constituting an explanation for that property. For instance “suction” is an emergent property of a tornado, but nobody expect “suction is emergent” to constitute an explanation for why tornados are able to lift heavy objects high in the air.
And it was to counter that claim of yours (that people were palming off “it’s emergent” as an explanation for consciousness), that I presented you with literature in which actual explanatory models are offered. These are fairly convergent, in fact, and as I said earlier, tend to involve the re-entrant looping of simulated output back as input into action-selection processes. Therefore I did not lie. I do not lie.
But they cannot constitute a solution to Chalmers Hard Problem, because it, by definition, cannot be solved empirically.
[It might be worth moving this side discussion to its own thread - it has nothing to do with the OP.]
TB, it seems there is someone else who cannot even get the message sent by the functionally specifi complex organisation of a fishing reel, much less a protein synthesis system. And BTW, your quarrel is with Orgel and Wicken, not me, but then you likely have not read what hey have stated on record since the 1970′s, never mind it is cited in this very thread. Which of course underscores the point I have repeatedly made about lack of any serious intent to engage actual evidence facts and logic on the part of too many objectors to design thought — who seem to be here only to project agit-prop talking points. Schoolyard level name-twisting taunts, TB, say a lot, a lot that is not to your credit. KF
PS: Let me again clip, just for reference, from my IOSE summary page:
http://iose-gen.blogspot.com/2.....l#fsci_sig
>> D: The significance of complex, functionally specific information/ organisation
The observation-based principle that complex, functionally specific information/ organisation is arguably a reliable marker of intelligence and the related point that we can therefore use this concept to scientifically study intelligent causes will play a crucial role in that survey. For, routinely, we observe that such functionally specific complex information and related organisation come– directly [[drawing a complex circuit diagram by hand] or indirectly [[a computer generated speech (or, perhaps: talking in one's sleep)] — from intelligence.
In a classic 1979 comment, well known origin of life theorist J S Wicken wrote:
The idea-roots of the term “functionally specific complex information” [FSCI] are plain: “Organization, then, is functional[[ly specific] complexity and carries information.”
Similarly, as early as 1973, Leslie Orgel, reflecting on Origin of Life, noted:
Thus, the concept of complex specified information — especially in the form functionally specific complex organisation and associated information [FSCO/I] — is NOT a creation of design thinkers like William Dembski. Instead, it comes from the natural progress and conceptual challenges faced by origin of life researchers, by the end of the 1970′s.
Indeed, by 1982, the famous, Nobel-equivalent prize winning Astrophysicist (and life-long agnostic) Sir Fred Hoyle, went on quite plain public record in an Omni Lecture:
So, we first see that by the turn of the 1980′s, scientists concerned with origin of life and related cosmology recognised that the information-rich organisation of life forms was distinct from simple order and required accurate description and appropriate explanation. To meet those challenges, they identified something special about living forms, CSI and/or FSCO/I. As they did so, they noted that the associated “wiring diagram” based functionality is information-rich, and traces to what Hoyle already was willing to call “intelligent design,” and Wicken termed “design or selection.” By this last, of course, Wicken plainly hoped to include natural selection.
But the key challenge soon surfaces: what happens if the space to be searched and selected from is so large that islands of functional organisation are hopelessly isolated relative to blind search resources?
For, under such “infinite monkey” circumstances , searches based on random walks from arbitrary initial configurations will be maximally unlikely to find such isolated islands of function . . . >>
Y’know, just a few dismissible IDiots — NOT — such as Orgel, Wicken and Hoyle.
PPS: The Marxists I had to deal with in the 1970′s and 80′s were very real, up close and personal. The Cess demonstrations incident of confrontation with Harmon Barracks paramilitaties n blocking Old Hope Road was very real. The spreading of the subversive ideas of a certain Neo-Marxist, Saul D Alinsky since the 1960′s is very real, and is more and more characterising commonly seen patterns of “Community Organiser” and
“Grassroots”[Astroturf] agitators, who do use agit prop techniques that were rooted in places such as Moscow, Frankfurt and Chicago. Most of those cught up in such nihilism do not have aclue the roots of what they are doing. And the cyberstalking and likely on the ground stalking I have had to deal with are real issues, not figments of imagination. Your mocking dismissal o what you either do not know anything about but are willing to enable, or else do know about but wish to enable, speaks tellingly about you. Someone, I suspect is — from the perhaps significant echo of another web handle belonging to a cyberstalker and hate web site operator — maybe right in the heart of it. FYI, I just had a follow up conversation with the local authorities.kf, you’re full of it. You’ve got NOTHING to report to “the local authorities” or any other “authorities”. You’re just making up all of your malicious accusations and you know it, I know it, and lots of other people know it.
Didn’t the “President” of this hate-site recently say that assertions aren’t evidence? All you’ve got are assertions, Gordon, and they’re all lies. They’re just a part of the childish professional victim game you play to make it look as though you’re a persecuted messiah like the imaginary character jesus. You poor thing. LOL
Your cowardly leader, “President” Arrington, deleted my last comment and others will likely soon follow. Why are you IDers such cowards? You’re terrified to face reality out in the open. You obviously believe that you’re winning some sort of victory here in your sanctuarial echo chamber but you’re just making fools of yourselves and showing the “onlookers” how corrupt and gutless you are.
Now, Gordon, go and type several thousand more words filled with lies and FIASCO gibberish, and convince yourself that you’re a super hero. I’ll be laughing my ass off.
truthbringer has one valid point. CSI and FSCO/I are gibberish to the simple-minded. It is a prediction of both CSI and FSCO/I that our opponents will try to make a FIASCO out of them because they sure as hell can’t actually address them. Prediction fulfilled. Thank you.
And the sad part is all the have to do is step up and model unguided evolution- produce testable hypotheses for it and then test them. If successful then ID is doomed. Yet they choose to equivocate and misrepresent. And when called on it they get all high and mighty and nasty and belligerent. Then they run back to their respective swamps to declare victory.
Pathetic
Lizzie,
Is this the biology-to-consciousness mechanism you were referring to?
*consciousness depends on the emergence of language*
Mung: When is the last time I insulted you Mark? Just wondering.
Mark: I am being unfair to you and apologise for that.
Well, I was just thinking that maybe you’re due.
I’d hate for you to feel left out!
I have been and can be insulting. But I get insulted all the time by people posting here, some of them are even quite nice about it, but it’s still insulting.
If I say something is “nonsense” what I mean is, please stop insulting my intelligence, i.e., you’re insulting me.
So if that’s all I say it’s actually rather restrained.
CSI and FSCO/I are dead, Joe, but just for some laughs, how much CSI and FSCO/I is there in a female aardvark vs. a male aardvark? Show your work.
Are CSI and FSCO/I exactly the same thing?
“Yet they choose to equivocate and misrepresent. And when called on it they get all high and mighty and nasty and belligerent. Then they run back to their respective swamps to declare victory.
Pathetic”
Says the poster boy for equivocation, misrepresentation, nasty and belligerent, running back to his swamp to declare victory, and being pathetic. kf and Arrington have you beat in the high and mighty department, but not by a lot.
Elizabeth must have seen Upright BiPed heading this way.
Do they not understand that there were already semantic capabilities in every cell? Maybe cells are conscious too.
truthbringer, You are brain dead. That you ask this:
Proves it.
When have I equivocated and misrepresented? You are a liar. I know that every time I get accused of such a thing I support my claims while my accusers just keep accusing.
You are a poster boy for cry babies.
Aurelio Smith:
Perhaps something like a hill climbing search algorithm.
Wright:
That many!
From the OP:
So? It hardly follows from this that they are not searching for less than optimal solutions or in fact just any solution at all that helps them survive.
Right. Like you remained passive and just waited to be fed the last time your were hungry. Not likely. By the way, last time you fed yourself did you go searching for the optimal meal?
An organisms that affords itself of the opportunities is not passive in the process.
Stop insulting us.
Mung @ 451
I think I’ve done very good.
I’ve merely watched and … and … kept my mouth shut.
@ truthbringer
Please stop. There is a worrying similarity between your latest comments and those you are attacking.
Upright Biped says:
You’re not the only one. Jon Bartlett has been the only ID proponent so far making an attempt to address the OP, notwithstanding the late flurry by mung. I was hoping for a little more interest in a supposedly key component in ID thinking.
Smith,
I read your OP to the point you stated:
The weakness in this method is that ‘design’ is assumed as the default after eliminating all other possible causes.
…and I knew there was no reason to involve myself further.
To the mods, assuming anyone tends to housekeeping here,
This thread is becoming impossibly slow to load for me due to having to post via a VPN. I have asked before if someone could remove the block on my home IP address.
Anyway I’ll try to respond here to mung’s points until the page freezes indefinitely.
Aurelio:
All evidence to the contrary, of course.
We were hoping for a real criticism of of a key component in ID thinking. Your attempt was poor and the people you relied on had already been proven clueless.
Yeah, Joe, I knew you would chicken out of calculating aardvark CSI and FIASCO. How about this: calculate, for comparison, the CSI and FSCO/I in a new born human baby and a newborn chimpanzee, and in a 20 Year old human and chimp. Show your work. Maybe kairosfocus, your enabler, fellow traveler, and supporter and defender of your direct and implied threats of physical harm against people (at least one threat from your work computer got you fired from a job), will help you with your calculations.
Joe, for more refutations of your “key component in ID thinking” that pertains to the OP, go to TSZ. Of course you’ll only be able to read, not comment, because you were banned for posting your infamous “tunie” photo there. You’re the only person ever banned there.
truthblower- ALL living organisms contain CSI. You are obviously too stupid to grasp that simple fact. I read the ignorant spewage on TSZ, they are a clueless lot and exemplify all that is wrong with humanity.
I see that you cannot support any of your accusations. Typical cowardly sock puppet.
Elizabeth Liddle started an OP at her own blog and I see Professor Joe Felsenstein has responded to Jon Bartlett’s comment
I tried posting it here as I know most people here aren’t keen on following links but the attempt timed out. Anyway, here is the link. I’ll email Jon Bartlett to see if there can be a follow-up thread (Barry willing) as It is impossible for me to post a comment of any length now.
In conclusion, I’ll just remind anyone still reading of what I said in the OP:
The search for a solution to a problem is not a model of biological evolution and the concept of “active information” makes no sense in a biological context. Individual organisms or populations are not searching for optimal solutions to the task of survival. Organisms are passive in the process, merely affording themselves of the opportunity that existing and new niche environments provide. If anything is designing, it is the environment. I could suggest an anthropomorphism: the environment and its effects on the change in allele frequency are “a voice in the sky” whispering “warmer” or “colder”. There is the source of the active information.
Active information is no more useful at establishing “design” from “non-design” than the “explanatory filter” of yore and the concept of CSI. ID has not shown us how to separate the signal from the noise.
Aurelio:
That is the whole point, duh. However in an ID context it is a search and active information makes complete sense.
Umm active information refers to the information computer programs have- those programs that are alleged to simulate unguided evolution, ie natural selection and such. They wouldn’t find their solutions without it.
Dr Spetner’s built-in responses to environmental cues is an example of active information in biology.
The EF works and the concept of CSI is still sound. You just have no idea what you are saying and you think your ignorance means something. Strange.
AS:
A statement in disregard of truth both presented in the thread from its earliest stages and subsequently brought to your attention when you attempted in 250 above, to sweep away a range of responses.
This speaks volumes, again and reflects a longstanding pattern on your part.
FTR, I point to 304 above, which is a round-up that deals with the first couple of dozen comments, by which point the OP was sufficiently answered and shown to be a forest of strawman caricatures:
http://www.uncommondescent.com.....ent-561159
KF
PS: Onlookers, the need to make reference to the long FTR at 304 did not have to wait for years, within days it has proved its worth. AS et al forever after cannot claim to have not had cogent detailed reply, without resorting to false assertion. Which what was done at 250 proves a willingness to resort to.
PPS: 313 clips Marks and Dembski, showing how the OP misrepresents the link between Needle in haystack blind search, Active information and FSCO/I.
AS, you have a turnabout, he hit back first problem. I am fairly sure TB is a years long operator of a major hate site and a slander specialist. What you see or may have seen above is a minor, toned down sample of what we have been dealing with and which several attack sites have been hosting/ facilitating/ enabling to different degrees. When you jumped on me for pointing to suspicious timing and enabling behaviour issues, this operator is, I am fairly confident, one of my major concerns. KF
UP said.
I would certainly examine at least one of them. To do otherwise would be irresponsible.
I say,
I would be more than happy to examine any argument for how consciousness could arise from matter in a step by step process.
I’m not asking for a fully developed theory or even an informed speculation I’m only asking for a few sentences that explain how such a thing is even possible.
Keep in mind that I have linked in this very thread mathematical proof in a peer reviewed main stream paper that such a thing is in fact impossible.
mathematical impossibility is a pretty high hurdle to jump don’t you agree
I would think that if a process for accomplishing the impossible had been detailed we would have heard about it.
UP says,
We are talking about the nature of consciousness. A subject that one side of the argument admits is not settled.
I say,
I’m sorry but it is settled. If unitary consciousnesses exists it is not computable. In other words it can not be arrived at by a step by step process.
There is no debating mathematics it’s either true or not.
peace
Mark Frank says,
You have illustrated my point! VJ is well informed enough to know that this is by no means obvious.Dualism has been rejected by very respectable people at least since Ryle’s Concept of Mind and arguably long before.
I say,
I’m not advocating dualism so I’m not sure what that has to do with me. I’m only pointing out that matter can not produce consciousness by a step by step process
You say,
You may disagree with UP but to claim he/she is obviously wrong and therefore insincere when his/her opinion is widely held by major figures in the field is the equivalent of putting your fingers in your ears.
I say,
I think you misunderstand what is being said here.
I understand that lots of smart people think that matter emerges from mind. I’m not even arguing that it can’t.
I’m only asking that materialists explain how such a thing is possible, they owe us that much.
by the same token
I would expect that if UP was truly an ID supporter he would be at least vaguely familiar with the limits of algorithmic processes.
If someone claims to be an IDer and at the same time says that matter can produce mind in a step by step process I doubt their sincerity,
It’s not about putting my fingers in my ears it’s about actually paying attention to what others are saying.
I hope my blunt speaking did not just cost me membership in the polite group
peace
fifthmonarchyman: I would be more than happy to examine any argument for how consciousness could arise from matter in a step by step process. I’m not asking for a fully developed theory or even an informed speculation I’m only asking for a few sentences that explain how such a thing is even possible.
Consciousness can be as simple as being aware of sensory inputs. The brain has memory, and that allows consideration of those sensory inputs. The memory can also be used to draw forth internal images to form models, and these models can include a model of oneself.
fifthmonarchyman: Keep in mind that I have linked in this very thread mathematical proof in a peer reviewed main stream paper that such a thing is in fact impossible.
Are you referring to Maguire et al., Is Consciousness Computable? Quantifying Integrated Information Using
Algorithmic Information Theory, Proceedings of the 36th Annual Conference of the Cognitive Science Society 2014?
Z: Are you referring to Maguire et al., Is Consciousness Computable?
Okay. Found your link above. That is the correct paper. A mathematical proof depends on its assumptions, which may or may not comport with claims about the natural world. In this case, there’s a couple of evident problems with those assumptions.
They define integrating function such that “the knowledge of m(z) does not help to describe m(z’), when z and z’ are close”, which is exactly contrary to how people learn and develop understanding.
They also state, “An integrating function’s output is such that the information of its two (or more) inputs is completely integrated.” But we know from simple observation that people integrate information incompletely. In other words, information is always lost during the process of learning. People integrate new knowledge within the parameters of what they already know.
I wrote:
Joe:
Nothing in your response addresses what I actually wrote. Specially, I pointed out that reductionism is a specific view about science. Nor is it necessary when explaining physical systems in constructor theory. So, your argument is parochial in nature by way of being unnecessarily narrow in scope.
See this article on reductionism.
This limit is exactly what constructor theory’s new mode of explanation is designed to avoid.
Joe:
Materialism is a particular philosophy of science that posits what I posted.
It’s unclear which part of “what you posted” you’re actually referring to. Why don’t you start out by quoting what you think materialism posits.
I wrote:
Joe:
The response “The variations that help.” doesn’t indicate where the knowledge of which variations are helpful should be made under which conditions (as opposed to variations that would be unhelpful) is located.
For example, I can’t just show up at a genetics lab and vary a bacteria to, say, eat fossil fuels. That’s because I do not possess the knowledge of which variations would result in just the right proteins, which would restful in just the features “that help.” If I did successfully intercede from the outside to vary such a bacteria in such a way, it would because the right knowledge of what transformations that should occur was present. Namely in me.
That’s my key point.
So, again, in your theory that is not anti-evolution, where is the knowledge what variations that would be helpful for specific organisms under specific conditions located? I’ve already provided two options…
But feel free to fill in the blanks with one of your own.
I wrote:
Joe:
I’m attempting to take what I think your theory is seriously, for the purpose of criticism. That’s how we make progress. Yet, you’ve done neither to actually advance the discussion. ”
If your view doesn’t fit one of the two above, then please indicate what your view is and how it differers from those presented. Merely saying “The ones that help” doesn’t actually address the question.
Again, you seem to be suggesting the knowledge was present at the outset, so where was/is it located? What form did/does it take?
5MM, I think it would help to say 128 above, amplify Integrated Information Theory, and link the paper again: http://arxiv.org/pdf/1405.0126v1.pdf All best, KF
Mung @ 454 –
If the populations are searching for anything (I’m not sure it’s a good metaphor, but let’s go with it for the moment), then it’s for a part of the search space that has a higher fitness. So for a population at median fitness, the target is half of the search space!
A corollary of this is that the search for the search will (I assume) tend to take place at lower fitnesses, so the search does not need to be very efficient, as the target is big.
TB,
You know or should know — as it was again brought to your attention via an extensive citation of Orgel from 1973 — that the information content associated with FSCO/I can be derived from the chain length of structured Y/N q’s to provide a wiring diagram level system description (thus pointing to Kolmogorov on the Mathematical side and for practical purposes AutoCAD etc as has been repeatedly highlighted for years).
But also, as has been pointed out, the pivotal point of the needle in haystack blind search challenge — pointed to in say the opening words of the Marks-Dembski 2010 article on active information — is that FSCO/I is fundamentally a threshold of specified complexity issue. Once there is good evidence that we are beyond 500 – 1,000 bits of FSCO/I, especially dFSCI, blind chance and mechanical necessity cannot credibly mount a feasible search.
So, while reducing an Aardvark or a human baby or a 6500 C3 reel to a detailed, assembly instruction level comprehensive engineering drawing is a serious undertaking (and one that for life forms would at present be beyond reasonable resources) we do not have to do that. A subset of the whole that carries us beyond the threshold is enough.
For the fishing reel — as was pointed out in reply to talking points but was ignored in the rush to trumpet an objection — the main gear already is well beyond 143 ASCII characters of descriptive info to specify its 3-d mesh description.
For a life form, a protein of length 300 or so AAs, given the deep isolation of protein fold domains in AA sequence space, is already enough, especially as complex life forms have typically hundreds of proteins that are unique, coming from very small domains.
But the pivotal issue is actually well before such, it is OOL, the root of Darwin’s Tree of Life: origin of an encapsulated, intelligently gated, metabolic nanotech automaton with integrated codes and algorithms using von Neumann kinematic self-replication facility. We know that just the genetic info for this is ~ 100 – 1,000 kbits, well beyond the threshold.
And for origin of the many dozens of major body plans, we are looking at 10 – 100+ million bits, dozens of times over and within the gamut of ~ 600 – 1,000 MY on Earth.
There is no empirically observed causally adequate blind watchmaker, needle in haystack mechanism that can credibly surmount such challenges. Nor is any such in prospect.
This means the root and the main branches of the conventional tree of life as will be found in typical textbooks etc is without empirically adequate foundation.
Bring to bear so-called horizontal transfers and you are looking at the collapse of the leading Darwinist icon, ToL.
The only empirically warranted, causally adequate factor known to account for FSCO/I is design. So, whether or no it fits your preferences we are fully warranted as a scientific, inductive inference to conclude that the best current (and prospective) explanation for the FSCO/I in the world of cell based life from microbes to Mozart is design.
Schoolyard nickname taunts do not change that, nor can angry projection of personal attacks and slanders or stalking online or on the ground including of increasingly remotely connected people. Not to mention the threats directly implicit in outing tactics involved: we know you, we know where you are, we know those you care for and where they are/can be ambushed, and more . Where, FYI, freedom to speak is not an absolute, that is why there is a law of tort and particularly of defamation; which in the sort of UK-based jurisdiction you have likely now traipsed into, is far more stringent than what you have become used to in the USA with its flawed Court decisions across decades. And UK based law on stalking, electronic and on the ground, is stringent also. And BTW, trying to jump in on a case of manifest abuse of parliamentary privilege to defame, is most ill advised as the ancient powers of a parliament to deal with contempt of parliament are quite serious. As Erskine May and others will attest.
And those who have enabled you and others for years should know better.
Not least, they need to know that things that seem acceptable step by step can enmesh them in deep shark-infested waters should those they have cossetted who show signs of dangerous instability explode nastily. As the case of Abraham Lincoln’s assassination shows as the unbridled rage/hate and ill founded sense of zeal in what he perceived as his right tied to unhinged contempt for others lurking in Booth and his influence over Powell et al including the Surratt family, boiled over into sudden violent extremism.
“Game” over.
KF
Bob O’H: You are begging the pivotal question and implicitly addressing a strawman version of the design case. The issue is not incremental progress within an island of function but to FIND such via blind needle in haystack search, starting with Darwin’s pond or the like prebiotic environment, then to address origin of body plans, all on observed, demonstrated causally adequate factors shown to be able to create FSCO/I. Intelligently directed configuration is the only empirically warranted cause of FSCO/I. KF
F/N: Some useful reading at ENV:
http://www.evolutionnews.org/2.....67421.html
Key clip from Gauger et al in reply to a case of debating the controversy that must not be named:
>> Wilf and Ewens argue in a recent paper that there is plenty of time for evolution to occur. They base this claim on a mathematical model in which beneficial mutations accumulate simultaneously and independently, thus allowing changes that require a large number of mutations to evolve over comparatively short time periods. Because changes evolve independently and in parallel rather than sequentially, their model scales logarithmically rather than exponentially. This approach does not accurately reflect biological evolution, however, for two main reasons. First, within their model are implicit information sources, including the equivalent of a highly informed oracle that prophesies when a mutation is “correct,” thus accelerating the search by the evolutionary process. Natural selection, in contrast, does not have access to information about future benefits of a particular mutation, or where in the global fitness landscape a particular mutation is relative to a particular target. It can only assess mutations based on their current effect on fitness in the local fitness landscape. Thus the presence of this oracle makes their model radically different from a real biological search through fitness space. Wilf and Ewens also make unrealistic biological assumptions that, in effect, simplify the search. They assume no epistasis between beneficial mutations, no linkage between loci, and an unrealistic population size and base mutation rate, thus increasing the pool of beneficial mutations to be searched. They neglect the effects of genetic drift on the probability of fixation and the negative effects of simultaneously accumulating deleterious mutations. Finally, in their model they represent each genetic locus as a single letter. By doing so, they ignore the enormous sequence complexity of actual genetic loci (typically hundreds or thousands of nucleotides long), and vastly oversimplify the search for functional variants. In similar fashion, they assume that each evolutionary “advance” requires a change to just one locus, despite the clear evidence that most biological functions are the product of multiple gene products working together. Ignoring these biological realities infuses considerable active information into their model and eases the model’s evolutionary process.
(Winston Ewert, William A. Dembski, Ann K. Gauger, Robert J. Marks II, “Time and Information in Evolution,” BIO-Complexity, Volume 2012 (4).) >>
A bit more food for thought.
KF
PS: So is this comment in the same piece by Luskin:
5MM #471
I certainly did misunderstand you – not entirely my fault I think.
In #471:
In #423 you wrote:
To me that’s a pretty good definition of dualism.
In #471
In #423:
That seems to me to be saying that matter mind cannot emerge from matter in a “step by step algorithmic process” because of dualism. I don’t understand how this differs from Mind cannot emerge from matter. How can things emerge other than step-by-step and what is the difference between and algorithmic process and any other?
In #471
I can’t see where you asked that in #423. And why should it be impossible unless you are a dualist?
I too am not familiar with those limits. In fact, as explained above I am not sure what an algorithmic process is. But as you didn’t include this term until #423 it is a bit hard to criticise UP for not addressing it before then!
Popp:
What you wrote is incoherent.
Yes, I know that it is.
Incoherent. It’s called contingency. That means it all depends on the context.
That is because you don’t know how to design organisms.
I don’t even know what that means. Mutations happen, it is a fact. What is the alternative to my idea, that they just happen?
They don’t look like options to me. They look like a child’s rant.
Then read Spetner and Shapiro.
It’s called Intelligent Design. A computer’s know;edge is present at the outset and can be updated.
No form at all as it is software, ie immaterial.
MF says,
I certainly did misunderstand you – not entirely my fault I think.
I say,
I was not blaming you Ive often been accused of not spelling out my position clearly enough. I assume that if someone as slow as me can get it would be obvious to all.
me before
Matter and mental are entirely different categories of substance.
you before
To me that’s a pretty good definition of dualism.
I say,
I don’t think it is. As a materialist you don’t hold that the number 2 is made of atoms do you? Mind is like the number 2
you say,
That seems to me to be saying that matter mind cannot emerge from matter in a “step by step algorithmic process” because of dualism.
I say,
No it is saying two things
1) Matter can not give rise to mind anymore than a hydrogen atom can give rise to the number 2.
2) Consciousnesses can not be achieved via any step by step processes.
That is not to say that it’s not possible that certain configurations of matter are conscious. But it behooves the materialist to explain how such a thing can happen.
And “it had to arise” does not count as an explanation
you say,
How can things emerge other than step-by-step ?
I say,
That is the ten thousand dollar question. I honestly have no idea given your worldview how any whole thing at all can arise other than step by step.
This is simply the age old problem of the ONE and the Many.
This is not a problem for my worldview in that I hold that whole things and the particles that constitute them are equally ultimate.
you say,
I too am not familiar with those limits. In fact, as explained above I am not sure what an algorithmic process is.
I say,
you might start here
http://en.wikipedia.org/wiki/Algorithm
Then move to here see one of the many limitations of this sort of thing.
http://en.wikipedia.org/wiki/Halting_problem
ID when you boil it down is simply a claim that life and the universe can not be accounted for by algorithmic processes. I would hope that UP would know that.
As far as me not mentioning algorithms before I assumed it was obvious given that any materialistic explanation would be algorithmic in nature as you said.
from here
http://en.wikipedia.org/wiki/D.....erous_Idea
quote:
Dennett says, for example, that by claiming that minds cannot be reduced to purely algorithmic processes, many of his eminent contemporaries are claiming that miracles can occur.
end quote:
That sort of claim is much more in my wheel house than yours don’t you agree?
peace
This rejection of dualism stems from the days that ppl still had a clear understanding of what matter was. Given that understanding of matter the interaction with the mental poses severe problems. But what is our current understanding of matter?
In quantum physics the causal role of consciousness (observer) is an open debate. How about string theory? And no one knows what energy is.
IOW it is much more unclear today how to formulate the interaction problem, since we no longer have one concept of matter.
Given what we currently understand about “matter”, materialism is dead and dualism is an unnecessary philosophical concept. The experience of matter in any practical sense appears to be orchestrated by mind acting on and through a field of information. There is no “interaction problem” because matter is an illusion generated by mind, albeit a very convincing one.
WJM, Actually, the detail and surprising nature of the interaction suggests that the two perceptions are accurate: the self acting reflexively on itself and through interfaces such as hands, legs and mouths, the other. Where the other includes conscious beings like as we are and passive entities that are material. We may decompose the macro level physical interaction and find a puzzling micro world but that does not undermine the macro. It grounds it. KF
fifthmonarchyman: Then move to here see one of the many limitations of this sort of thing.
Humans haven’t solved the halting problem either.
An analog neural net can only be approximated algorithmically.
Rosenberg (yes he again), seems to be aware that there are some serious problems at the outer and inner “boundaries” of the concept of matter.
[Rosenberg, The Atheist's Guide to Reality, ch.2]
> Humans haven’t solved the halting problem either.
When the drill sergeant said halt we halted.
Bob O’H:
Why is evolution modeled as a search?
Opponents of ID argue both that evolution is a search and that it is not a search.
Opponents of ID argue both that genetic algorithms are search algorithms and that they are not search algorithms.
Opponents of ID argue both that genetic algorithms are accurate models of evolution and that genetic algorithms are not an accurate model of evolution.
What’s going on here? Can you shed any light on this?
Joe,
If what I wrote is incoherent, then I would expect you to differentiate your position from it. Yet, the great majority of your responses merely repeat what I wrote, minus key differentiations I’ve made.
Examples?
Paraphrase of what I wrote:
Joe wrote:
“I know it is”, isn’t an philosophical argument for why reductionism should be the only mode of explanation in science.
Paraphrase of what I wrote:
Joe:
You’re not actually disagreeing with me here either, yet I’m supposedly incoherent?
I wrote:
Joe:
That’s what I wrote, Joe. I just was more specific. Namely, knowing how to design an organism requires possessing the knowledge of what transformations would be necessary to result in just the right features that would be helpful under specific conditions. You’re not actually disagreeing with me. Nor are you engaging my arguments. It’s unclear how this makes what I wrote incoherent.
Joe:
Then you shouldn’t have any problem providing specific criticism that indicate why. Please be specific.
Joe:
You can’t paraphrase? Then a specific reference, please.
Joe:
I know what it’s called Joe, If I’m going to understand it beyond “that’s just what a designer must have wanted”, that means taking the theory seriously, as an explanation for what we observe, along with what appears to be uncontroversial aspects of biology. That’s what I’m trying to to, Joe. You want me to take your theory seriously, right?
Cars and laptop computers do not self-replicate. That is, they do not contain the knowlege of what transformations would be necessary to make copes of themselves. Nor do they execute them. (Well, a laptop computer could hold the instructions a robot would need to build it, but the robot actual does the transformations, not the laptop.)
On the other hand organisms do not appear out of thin air. Nor are they built in “organism factories”. Rather, they self-replicate. And they do so using the knowledge of what transformations of matter should occur to make copies of themselves that exists in the form of DNA in each cell. This is a key difference.
An organism making a copy of itself and varying its DNA in ways that are “helpful” are both transformations of matter. It’s unclear why the former would occur with the requisite knowledge of what transformations to make under the right circumstances being present, but not the latter.
Joe:
In practice, computers are physical things, regardless if they consist of cogs, transistors or qbits. Programs exist on physical storage media of one form or another. If I take the SSD out of a laptop it won’t boot. If I delete a program of disk, i can execute it. In the same sense, if a cell itself is going to respond with variations that are “helpful” under a matrix of external conditions, the question is, where is the knowledge of which responses that meet that criteria located?
And, if it’s not in the cell, then how does the cell have anything to do with the response? If none of the above, then is that knowledge somehow present in the laws of physics?
WJM:
There is no “interaction problem” because matter is an illusion generated by mind, albeit a very convincing one.
I am sure that will be a comfort to the people of Nepal that it is only a illusion that buried their illusionary relatives. Luckily the problem of duality has been solved by removing the material world.
Is it self evidently wrong to torture an illusion for pleasure?
Popp:
I never made that claim. Obviously you have other issues.
Good luck with that.
That means they are less complex and therefor nature should be able to produce them.
@Box#487
Not knowing everything exhaustively doesn’t mean we know nothing and cannot solve problems. What I want from a theory is its content, not its providence.
I wrote:
Joe:
That’s my point, Joe. You didn’t do so explicitly. Rather, you implicitly assumed that was the case as part of your claim that neo-darwinism cannot explain anything, scientifically.
That’s what I meant when I said your claim was parochial (unnecessary narrow in scope).
I wrote:
Joe:
How is this relevant to what I wrote?
velikovskys said:
Even if the appearance of matter is illusory, that doesn’t mean that what the material illusion represents is not real. It is certainly a comfort to hundreds of millions, if not billions, who believe that the material bodies of their loved ones is not all there is, and that after death what the body represents continues to exist.
Are you really that unfamiliar with the religious beliefs of billions of people concerning the roles of matter and spirit/mind?
Popp:
It explains disease and deformities rather nicely. That is about it.
Getting back to the thread, Darwinism has always been the idea that knowledge genuinely grows, though variation and selection. With the advent of DNA, we more specifically say variations in the knowledge of how to build copies of an organism occur that are random to any specific problem to solve, which are then tested by the environment and errors are discarded.
If active information somehow improves this process, it too would represent knowledge about what variations would be helpful in specific environments, as opposed to other variations that are not helpful in those same environments, etc. Where is it located? What form does it take? How does it improve a search?
Popp:
Test it, then.
But “random to any specific problem to solve” does not = happenstance and undirected. Ones and zeros appear to be random when you look at them on a computer buss but we all know they are directed by the programs.
That is why the OoL is KEY. Only if Darwinian type processes produced living organisms would we think all mutations are accidents, errors and/ or mistakes, ie undirected, unplanned. And guess what? Those processes cannot account for basic biological reproduction. Darwinism fails as it is a non-starter.
In the cell. We can pinpoint it by trying to make artificial life by using and replacing parts of an existing form. Venter demonstrated it isn’t in the DNA.
SEARCH is the key word. We answer those question via investigation. ID says that information is there so all we have to do is flesh it out.
Two words- research project!
What form does it take? How does it improve a search?
Popperian:
A General Theory of Information Cost Incurred by Successful Search:
Active information is a measure. Your questions don’t even make sense.
Popperian:
As was long since pointed out to EL in 85 above, this disanalogy argument failed on the merits c 1804, 50 years before Darwin’s theory was given currency.
I keep being astonished by the general ignorance of Paley’s part 2 to the watch found in a field thought exercise (in ch 2 of his Nat Theol, the Chs I and II being short), which can be slightly updated once we see that the living cell is an encapsulated, gated, nanotech using metabolic automaton, with an integrated, code & algorithm-using von Neumann kinematic self replication facility:
In other words, going to the root of the ToL, we face the fact that the self replication facility is itself FSCO/I rich, e.g. stored digital code in DNA, the nanotech of protein synthesis [where TRNAs are universal CCA-joint position arm devices with AA attachment there, and prong height templating to code in succession to chain AAs to make proteins. With step by step processes -- algorithms -- with defined halting.
As just one aspect.
Given that Darwin knew Paley's work and used it as an implicit foil, and given the fact that von Neumann was 60 years past, something is wrong.
Deeply wrong.
So, Cars and notebooks do not self replicate. They exhibit FSCO/I but at a LOWER level than a vNSR bearing machine system. There is some progress down that line with 3-d printers etc, and this would mark Industrial revolution 3.0.
Pointing to economy transformation and solar system colonisation.
Yes, this is not airy fairy stuff.
But, we must realise that the living cell was there long ago, using molecular C-chemistry based nanotech. For all sorts of reasons.
And as just outlined, a vNSR is a high application of FSCO/I. Indeed, in my IOSE I summarise it thusly:
The attempted disanalogy argument fails (in a way that raises troubling concerns about strawman caricatures of longstanding design thought), and points out an entire onward class of FSCO/I at work in the living cell. Where, for excellent reason, the known causally adequate source of FSCO/I is intelligently directed configuration.
And BTW, I have personally emphasised just this point in and around UD for years.
KF
PS: Just looked up on Google. The first three images are mine, the 4th is a Wiki Image I use that comes from NASA.
Wjm:
Even if the appearance of matter is illusory, that doesn’t mean that what the material illusion represents is not real.
It doesn’t mean that it is real either, your mind has already demonstrated that it can create convincing immaterial illusions.
It is certainly a comfort to hundreds of millions, if not billions, who believe that the material bodies of their loved ones is not all there is,
But you are saying that the material bodies of their loved ones never existed in the first place, why should a non existent thing have an immaterial mind ?
and that after death what the body represents continues to exist.
Again, the body is an illusion why is what it represents not the same illusion?
Are you really that unfamiliar with the religious beliefs of billions of people concerning the roles of matter and spirit/mind?
Most religious beliefs recognize the existence of a material world, you do not seem to.
MJM says,
Even if the appearance of matter is illusory, that doesn’t mean that what the material illusion represents is not real.
I say,
Sort of like this
http://www.sciencedaily.com/re.....101633.htm
velikovskys said:
I didn’t say the material bodies “never existed in the first place”, I said they existed as illusory representations of what was real in the first place – representations of mind or soul. Illusions are real as illusions, even if they also represent something real.
@KF#501
While Paley helped clarify the problem, his solution doesn’t actually solve it.
The difference between Paley’s rock and the watch wasn’t that one could serviced a purpose while the other could not. A rock could function a paper weight, a weapon, or a construction material, etc. Rather, the key difference was that the watch was well adapted to a purpose (telling time), while the rock was not.
The sun can also be used to keep time, but it could do so just as well if it was varied to even a great degree. This is because the sun wasn’t well adapted to keeping time in the first place. However, this isn’t the case for Paley’s watch, as good designs are hard to vary. It would be hard to vary key aspects of the watch greatly and have it perform just as well at keeping time.
Just as we can use knowledge to transform unadapted raw-materials in to highly adapted objects to suit our purpose, we can apply knowledge to use the sun for a purpose it was not well adapted to either. In the case of the sun, this knowledge exists in us and our sundials, not the sun itself. However, this knowledge does exist in both the watch (of how to tell time) and living organisms (how to make copies of themselves)
So, the question becomes, how did the knowledge (of how to tell time) find its way into the watch and a living organism? What is its origin? Here is where Paley could only conceive of a single explanation, and fails due to the problem of induction. Specifically, the inductive conclusion based on the fact that everything we’ve observed being designed had a designer.
We cannot fault Paley for not accounting for an infinite number of un-conceived explanations for knowledge creation, including the means which was later discovered by Darwin. Furthermore we can credit Plaley for presenting a better understanding of the problem. However, his proposed solution actually failed to solve it. In fact his solution, creationism, ruled out his own argument.
Should we substitute Paley’s ‘designer’ for ‘watch’, we force him to the “[inevitable] inference […] that the [designer] must have had a maker”
Paley’s designer must also be well adapted to perform the task of design. Furthermore, said designer couldn’t be easily varied to a great degree, yet still perform the task of design just as well, like the rock or the sun could. So, it would seem that his own argument contains a contradiction, which rules out Paley’s designer.
Popperian, First we can readily hold Paley to have made an inference to best current, empirically warranted explanation of origin of FSCO/I. On which the proper challenge is if you don’t like it provide another that meets the vera causa test of actually creating FSCO/I. Until then we can rest on the induction to best explanation. Putting up un-named speculative alternatives in the face of 2350 years of analysis on chance, necessity and design as key causal factors reeks of, I have no 4th alternative but am not willing to acknowledge the force of the longstanding three. Next, it is highly interesting that when I showed how by 1804 the disanalogy argument — which is commonly made — fails, you immediately changed the subject to an attack on inductive reasoning in general. That too speaks volumes by what you refused to answer cogently. And BTW, there is a longstanding analysis of necessary beings that unlocks the infinite regress of designers parody of induction. That someone or something is design capable does not lock us up to it must itself have been formed by a prior designer. And as an educated person you cannot properly claim to be ignorant of at least the candidate level possibility of a being of such a class. Where, the force of necessity is such that such a serious candidate will be either impossible as a square circle is, or actual. Besides, the ontological status of designers is irrelevant to the status of FSCO/I in something like the watch or the cell reliably pointing to it being designed, in short, you used a red herring. KF
I wrote:
Again, organisms are not built in an “organism factory.” Nor do they appear out of thin air. Rather, their concrete features are due to the knowledge they contain about how to make copies of themselves. Those features are adaptations of matter that occur when the knowledge in their DNA about what transformations to make to raw materials are performed.
Should some other knowledge be present, some other transformations would occur and some other features would result. Right?
So, the origin of an organism’s concrete features is the origin of that knowledge. Right?
Still following me so far?
Popperian, irrelevant again. The issue is that per a trillion item database FSCO/I is a reliable sign of design as causal process. Design is a process of intelligently directed configuration [which naturally tends to be informational], and that it leaves reliable markers in many cases which reliably point to causal factor is what is to be addressed. Without, trying to burn down inductive reasoning or else play at selective hyperskepticism. KF
TB, you seem to insist on abusive behaviour. I therefore point out that you yourself are a clear example — and likely a chief one — of the long term problem of fever swamp new atheistical cyberstalking and abusive web trollery cossetted by too many of the more genteel objectors to design theory, for far too long. I have no need to try to prove to you or your ilk what you likely know from the inside anyway on the recent escalation to what is likely to be on the ground stalking targetting even remote relatives, as well as traipsing in on an abuse of privilege case; recently removed from the web by a responsible editor with no thanks to you and/or your ilk, due to relevant UK law and natural justice. If you will not acknowledge that stalking, outing and target-painting amounts to: we know you, where you are, those you care for and where they are, all of which are implicit threats, then that simply shows just how dangerously hostile you and your ilk are. And those who will not police their fora and sites to stop such become enablers. The responsible authorities here have been and are being briefed, and the leadership of UD blog are in full possession of the relevant defamatory and trollish materials. Those who passively or actively enable such thuggish behaviour need to recognise what they are cossetting, never mind how genteel and highly principled they imagine themselves to be. The conclusion of the matter is simple: there is no right to defame, there is no right to play the troll, there is no right to demand hosting of defamatory or threatening or inciting materials or other forms of hate speech, there is no right to stalk. Which is actually a recognised crime and often serves as a stage to far worse crimes in the hands of the sort of ilk inclined to out of control rages, drink, drugs, nursing of real or imagined grudges, threatening people with weapons, obsessively collecting or caching weapons and the like. Indeed, if you were to read the story of Lincoln’s Assassination you would see just how exactly this pattern played out in a key historical case, how suddenly, once rage provided motive to back up means and opportunity. And responsible people know that those who refuse to learn from sound but grim history are doomed to relive its worst chapters. KF
PS: I just noticed, this month is the 150th anniversary of that horrific event, the cold blooded murder of a sitting US President by a rage-fuelled fanatic. It would do many a lot of good to ponder the account at Wikipedia as a quick first reference:
http://en.wikipedia.org/wiki/A.....am_Lincoln
TB has been shown the exit.
Well darn. I was sort of hoping that truthbringer would eventually bring some truth. So disappointed.
@kf#506
KF, my point is, regardless if we lacked of a better explanation now, as Paley did then, his designer still doesn’t actually solve the problem. It merely pushes it up a level without improving it. As such, it fails.
Nor am I changing the subject. Assuming the only sources of “design” is a designer because we had never observed any but designers designing things in the past, and had no better explanation at the time, is bad philosophy.
However, Darwin has since provided such a theory: complexity emerges from variation and selection. And that theory has withstood an overwhelming amount of criticism.
On the other hand, you’re appealing to is the idea that designers have this property of “design”, as if it’s a irreducible primitive which we cannot make progress. But that’s exactly what we have done. Make progress.
IOW, you’re denying that progress has been made on multiple levels in multiple fields including epistemology, information, etc.. And in many cases, it’s not just any denial, but denying that we can even make progress in those fields. in practice. At all.
To use an analogy, we’re busy making progress on details about a moving train, such as it’s exact departure time, exactly how many people are on board, how fast it’s traveling, when it will arrive, etc. While, at the very same time, you’re response is to deny that we can even say there is a train at all or that it even left the station.
One can ask, and get the proper answer, to the question, “who built Stonehenge” without explaining how the builders came into existence.
What examples can you provide?
Also…
How many mutations, what kind, and in what order, does it take to turn a cow into a whale?
Or a proto-Chimp brain into a human brain?
What are the quantifiable limits to the complexity that can be generated by the processes described by the Modern Synthesis?
Popperian,
Take an Abu 6500 C3 reel, i/l/o its FSCO/I. Designed. That is an adequate causal inference regarding the reel.
Take a cell in a human body, FSCO/I. Likewise what we may infer of the original cell. Design would be a very important conclusion regardless of ontological status of designers of cells. Within 100 years, based on progress to Venter et al, we will be able to do it.
Take now, the fine tuned, observed cosmos that is set to a locally very deply isolated operating point that enables C-chemistry, aqueous medium, cell based life. Even through a multiverse, this points to a designer capable of building a cosmos.
A design explanation for the particular case before us is a significant part of its back story, regardless of other onward discussions. As is a commonplace in science and other serious endeavours. One gets the impression, objection for the sake of objection, regardless of falling into selective hyperskepticism or even burning down whole classes of reasoning.
That, is not a normal behaviour pattern and bespeaks deep ideological problems.
Now, shift mental gears to address matters ontological and the like.
Let me clip a recent OP in which I did this. I do so, not because I expect any better responsiveness, but for record for the 99% who do not comment, now and hereafter. This replies to AS in the context of his attacks on the reasonableness of ethical theism.
It becomes important as this is a case of the reasonableness of reasoning based on a root necessary being as a terminal explanation of reality, as a reasonable option. That is, the objection that design implies infinite regress or circularity collapses once we move to worldviews foundations reasoning. And such an infinite regress of causes argument is inherently of that character:
Objection fails.
KF
Popperian:
Can you kindly provide say a 6,000 word or thereabouts feature article length essay, that — without lit bluffs etc — cogently summarises on evidence that is observational and warrants the causal adequacy claim of darwinist and extended claimed mechanisms across the tree of life, from root — OOL onward to trunk [to LUA] and main branches [OO Body Plans], thence onwards to us?
(Take M62′s questions as implied in this — thanks M62.)
This is of course the Darwinist essay challenge of 2 1/2 years standing, which is still open.
No truly serious response has ever been received.
There is a UD category on this.
KF
PS: My posting of that challenge is a key part of the backstory on a lot of things, onlookers.
Mung @ 489 – Can you give specifics and references to what you’re saying? It’s difficult to respond otherwise.
One possible source of confusion is that GAs are used as search algorithms in computer science. But this does not necessarily mean that evolution is a search itself. The idea of a GA has been re-purposed.
Bob O’H: Once something is made of an arranged cluster of parts, it is possible to consider the set of clustered or scattered arrangements, and to reduce that informationally to a structured set of y/n q’s that as a string specifically describes any particular arrangement. From this we have a configuration space. A blind walk across that space — whether connected, a dust or a combination — is then equivalent to a blind, needle in haystack search. From this, we may draw conclusions on the feasibility or otherwise of stumbling on shorelines of function amidst the zones of non function, i.e. the search for T in W is relevant. Where, for FSCO/I to be relevant the space size metric on description length is at least 500 – 1,000 bits, relative to gamut of sol system or the observed cosmos. The conclusion per straw to stack back of envelope calc, is that beyond this level it is maximally implausible that proposed atomic and temporal resources could credibly find such a zone. So, the analysis on blind needle in haystack search is relevant, and highlights the core issue for OOL and for OO body plans: finding shorelines of function in beyond astrinomical config spaces. Discussions on conveniently smooth fitness metric islands of function therefore beg two questions, getting to such shorelines, and roughness per results from Axe etc. We know protein fold domains are deeply isolated and structurally not accessible stepwise, we know there are thousands of such, we know that a great many are small in number of proteins and that many life forms have such isolated cases that presumably closely related organisms do not. The search challenge is real, serious and un-answered. It points to active info as likely cause of evident outperformance of blind needle in haystack search. It is ironic, too, given iconic Weasel etc and genetic algorithms and the like, used to promote the claimed feasibility of evolution, that suddenly we hear no evo is not in material part about blind search. KF
Bob O’H- The whole point is that GAs do NOT simulate natural selection. Thank you for admitting that they do not.
Elizabeth Liddle thinks that they do model unguided evolution. Perhaps you could straighten her out as she won’t listen to us.
Popp:
LoL! No one is arguing against mere complexity and Darwin’s “theory” still remains untested.
Too funny- Lizzie ran back to TSZ and declared that no one wants to support Active Information as an ID argument- she hasn’t even demonstrated that she understands what active information is!
Heck she thinks that CAs simulate natural selection- that is how desperately ignorant she is.
Joe
Given the first couple of dozen plus responses above and the round-up in 304 — which corrects many levels of fallacy in AS’ initial post and onward remarks, particularly an attempt to sweep corrections off the table at 250 — and clip at 313, could you obtain the EL clip for me?
For if your summary is accurate, she and those echoing her are willfully speaking in disregard to easily accessible and even highlighted truth, in hopes that their misrepresentations and false suggestions will be perceived as true.
I have documented that in fact active info, per the opening words of the 2010 Marks-Dembski paper, exists in the immediate context of blind, needle in haystack search process. That, given that a search is a sample from a config space of cardinality W, the searches therefore come from a space of cardinality 2^W which makes it instantly plausible that search for a golden search is at least as hard as direct flat random search.
Therefore use of such as a yardstick is reasonable and i/l/o the needle in haystack circumstances, on avg blind searches will not outperform the hopeless failure of flat vrandom search. Thus, it is reasonable to assess the impact of injected active info on search from the degree of over-performance. Which, is the active info metric.
But we do not need to go there, the simple circumstance of extremely small sample due to want of atomic and temporal resources on a sol system or observed cosmos scale makes it maximally implausible that such blind samples will hit on deeply isolated narrow zones such as FSCO/I naturally imposes. This, for need of wiring diagram specificity and complexity to achieve function.
Likewise, to assume away the challenge of finding shorelines of function and imposing neatly behaved fitness landscape architectures in the teeth of evidence of roughness, is to beg big questions.
The fact remains that on a trillion item base, the only empirically confirmed adequate cause of FSCO/I is intelligently directed configuration. AKA design.
Where, the reality of FSCO/I is not in doubt and objectors are directed to Orgel and Wicken for antecedents to this descriptive summary.
I find that we are not dealing with anything that resembles genuine discussion on merits. Which, needs to be recognised.
KF
@Joe#499
I wrote:
Joe:
You mean positively prove it? That’s not how science works, in practice. What we do is conjecture theories about how the world works designed solve specific problems, then criticize them and discard errors we find. And if some other theory comes along that not only explains the same phenomena just as well, but explains it better and more of it, then we discard the previous one all together.
The core of Darwin’s original idea has withstood over 150 years of significant criticism. That we cannot positively prove evolution is a fail problem for the theory it is an example of claiming we cannot make any progress at all.
Joe:
Neo-Darwinism is an alternative, non-authoritative source of knowledge, as defined by Popper, which genuinely creates new non-explanatory knowledge that did not exist before and was not present at the outset. It’s not completely random because It’s an error correcting process in which non-explanatory knowledge is created. This is outlined in the referenced paper, in detail, expressed in constructor theoretic terms.
From the abstract:
Joe:
And my point is, any such program would itself be knowledge about what outputs to generate from a set of inputs. Even if that were a range of potentially successful variations, as opposed to some other range of variations that would not be potentially successful. Those sets of variations would be knowledge about transformations of matter, just as each cell contains the knowledge of what transformations of matter needed to occur to make a copy of itself.
However, the term “Active Information” is incredibly vague. As such, it’s unclear how you can “add it” to non-active information, how it’s different from non-active information, etc. .
IOW, just as evolution is the origin of the knowledge of what transformations to perform to make a copy of an organism, it also is the origin of the knowledge for what responses a cell should make under a set of particular conditions. in both cases, that knowledge was genuinely created (did not exist at the outset).
You would be correct in stating evolutionary theory alone cannot provide a reductionist, step by step process, which people seem to be demanding here. However, not only does the paper explain why this is the case, it then goes on to provides just such a process in constructor theoretic terms.
IOW, constructor theory provides the means by which evolutionary theory can be formulated in a very specific, detailed way.
Joe wrote:
So, to answer my question, rather than the knowledge of what variations to make under specific conditions existing in the laws of physics at the outset, it was in the cell, at the outset. Is that what you’re suggesting?
mike1962: One can ask, and get the proper answer, to the question, “who built Stonehenge” without explaining how the builders came into existence.
The evidence indicates it was a peculiar species of tool-using ape that inhabits the third rock from the Sun, already known for building such structures.
mike1962: What examples can you provide?
A canonical example is the mammalian middle ear.
Which is my point. When one inquire about the proximate cause of an action, it is not necessary to inquire about the non-proximate causes. Thanks for your agreement.
Thank you. What kind, how many, and in what order did the “blind” molecular mutations occur in order to produce it?
mike1962: When one inquire about the proximate cause of an action, it is not necessary to inquire about the non-proximate causes.
If the posited designer appears out of nowhere leaving no evidence, then it would undermine the hypothesis. In the case of Stonehenge, we have evidence of the peculiar species of ape over millions of years, including in the vicinity of Stonehenge during the period in question, along with evidence of their building in stone.
mike1962: What kind, how many, and in what order did the “blind” molecular mutations occur in order to produce it?
There’s no way to reconstruct the genetic mutations that occurred, though we have some knowledge of the genes involved. However, we can largely reconstruct the incremental adaptive steps.
Thank you.
So then, my implied challenge to Popperian’s statement stands:
You have provided no evidence that complexity “emerged” by undirected Darwinian evolution which is what he is defending as having “withstood an overwhelming amount of criticism.”
He’s wrong. And you’re reply doesn’t help him/her.
Care to reply to the other questions I posed to Popperian?
However, (again), we do not need to explain the origin of the builder. Moreover, only in your opinion has the “builder(s)” of life left no evidence. Some people disagree. But that’s beyond the scope of this thread.
As for humans being “apes”, you are free to put them in that category if you choose, but I think that is an unfair characterization. There are many profound differences.
Popp:
No, I said TEST IT.
Natural selection, the core of Darwin’s idea, has proven to be impotent.
Blah, blah, blah- all meaningless drivel. Non-sequitur.
Not really. However Darwinism and evolutionism are incredibly vague.
Can you please reference this evolutionary theory you keep referring to?
Zachriel:
The only tools ape use are sticks. And only an imbecile would think that sticks were the tool used to build Stonehenge.
Enter Zachriel.
mike1962: Thank you.
Just to clarify, that doesn’t mean the genetic transition will always be obscure, just that current science has not been able to reconstruct the chain of events in any detail.
mike1962: You have provided no evidence that complexity “emerged” by undirected Darwinian evolution which is what he is defending as having “withstood an overwhelming amount of criticism.”
Actually, we have significant evidence of the evolution of the mammalian middle ear. The original data came over a century ago from studies of embryonic development. Those researchers showed that the same structures which led to reptilian jaw bones led to auditory ossicles in mammals. This strange finding meant that there should have been an evolutionary transition between these structures, but no one had any idea how such an *irreducibly complex* structure could have evolved incrementally.
Joe @ 519 – you’re putting words into my mouth. Please don’t – I have enough in there as it is.
Popperian:
Active information is precisely defined. Read the OP.
mike1962: However, (again), we do not need to explain the origin of the builder.
It’s part of the chain of entailments. While we might not have to explain everything about the designer, if there is no evidence of the designer, or the designer just pops in and out, then it will tend to undermine the hypothesis. While there will always be gaps in science—that’s the nature of knowledge—, the process is to continue to test the limits of the hypothesis.
So, with Stonehenge, archaeologists look for evidence of the builders, the use of the monument, the connection to surrounding peoples, the place in history, the origin of the people, what they ate, where they slept, anything and everything that can be learned, always testing each and every hypothesis. So far the evidence points to a peculiar species of tool-using amniote that evolved on the third rock from the Sun.
Mung (attn, Popperian), Active Information is both precisely conceptualised and a metric is developed for it. Cf 313 above and the onward linked. KF
Bob O’H, What words did I put in your mouth? Please be specific as what I posted in 519 appears to follow directly from what you posted in 517.
Joe – you wrote “The whole point is that GAs do NOT simulate natural selection. Thank you for admitting that they do not.”. But I made no such admission – I made no comment on whether they do or not.
Bob O’H- you wrote “One possible source of confusion is that GAs are used as search algorithms in computer science. But this does not necessarily mean that evolution is a search itself. The idea of a GA has been re-purposed.”
And that leads to my response as natural selection is not a search, let alone a search algorithm. However if you think that GAs do model natural selection then you are out to lunch and should not be teaching biology to anyone.
Joe – you didn’t write that natural selection is not a search in 519. Now you’re putting words into your own mouth!
Winston Ewert has responded to the post at Pandas Thumb by Felsenstein and English. Perhaps Jon Bartlett or someone else who can start OPs here would like to create an opportunity to comment on it.
Bob O’H, That is all I have been saying this entire thread. And that is what “The whole point is that GAs do NOT simulate natural selection.” refers to.
You lose.
Thanks Aurelio.
Felsentein and English raise a number of objections. However, their objections are directed against an argument we do not make. In fact, regarding the conclusion of conservation of information, they are in agreement with us.
Imagine that.
“Entropy is perpetually trying to break birds apart, but they remain alive.”
ok, now that made me laugh.
The use of the term “search” has led some to argue over whether or not Darwinian evolution can be considered a search. After all, Darwinian evolution is not a teleological process and does not search for a goal. However, all that we mean by search is a process that can be represented as a probability distribution. That means that all processes reducible to chance and necessity qualify as searches.
F/N: Reminds me of the story of rocket science. First, take a broomstick and support it on your fingertip as it stands vertically. Next, turn it into a rocket body that has to be light and will be broken it it tilts out of control. Replace the finger tip with a controlled explosion, shooting gases that you have to throttle and direct. Don’t forget the pumps to run the fuel together. Where of course if things break enough they go boom. Now, put a capsule on top, with people in it who need to be protected from many things that can go wrong. Next, integrate orbital dynamics where you want to go somewhere rather specific and need to bring back the people in one piece. Functionally specific, highly constrained complex organisation that is information rich and is on a balance point that would be all but impossible to achieve by blind chance and necessity. Now, add to this, that your rocket needs to be self replicating as an automaton — probably, by nanotech swarm . . . see significance of building things up from cells? What does this tell you? KF
Mung, Just you wait as they are preparing a
load of diatriberesponse to Ewert.Seriously, Felsenstein may be good at his profession but he sucks at analyzing and critiquing ID
Joe, have you got that EL clip? KF
Yes, kairisfocus, I haz it:
She said:
And right after that keiths attacks you. And you wonder why I just want to fight and get it over with…
Thank you
Thank you again
One bare possibility is as good as another.
My implied challenge to Popperian stands.
Zachriel: …no one had any idea how such an *irreducibly complex* structure {mammalian middle ear} could have evolved [via blind Darwinian mechanisms] incrementally.
mike1962: Thank you again
So the answer is “design”?
mike1962: One bare possibility is as good as another.
No, in science, the one that has testable entailments is the better hypothesis.
Zachriel says that ID is better science:
ID has the testable entailments while evolutionism does not.
Thank you, Zachriel.
Joe Felsenstein @ TSZ:
Well now we know that’s just false.
Unless every process can be represented as a probability distribution.
Elizabeth’s just a barrel of laughs. More later.
Joe, EL is speaking what she at minimum SHOULD know is false as a reasonable glance at the head of this thread will show. And that is in a situation where, days ago I corrected AS on that, as may be seen at 304 above. But then the whole OP to begin with is itself revealed to be a strawman caricature set-up and knock down, they do not seem to get the message that the needle in haystack search that sets the context for identifying, defining and using active information is directly tied to FSCO/I setting up narrow zones T in large config spaces W, that are to be found by blind needle in haystack search. And of course there is a series of papers that takes this up into general discussions but such is patent root context. All of this uncomfortably echos the transparent denials in the teeth of the vampire clergyman video smearing and scapegoating incident three years past. And BTW the opening salvos attacking me were on a personal blog post where I had spoken to porn issues with the Internet where — though I didn’t know it then — alluded to a line in the atheist’s anthem that spoke to churches having coffers of hate. In short the same circle full well exemplified the matter at hand, expressing preference for Sunday porn viewing over Sunday church attendance viewed as contributing to houses of hate. Something is seriously wrong with that sort of hate speech and bigoted view of Judaeo-Christian Theism. Then, imagine when we are back full circle to that same bigotry song when some of the circle tried to smear me at a local newspaper site where I stood up against abuse of parliamentary privelige by a local pol. And of course that is where by accusing me falsely of abuse and suggesting a venue not connected online the implicit threat was dropped: we know you, we know where you are, we know those even remotely connected and where they are. If that is not a manifestation of stalking and ugly, ugly threats, Mafioso style, nothing is. Those who insistently cossett such need to realise what they are enabling. KF
PS: So far as I know KS is not outright stalking [the connexions online go other ways and the on the ground aspects point other ways unless his handle connects to people that would be most surprising . . . ], though obviously he seems to be part of the enabling. The circle of objectors needs to take a serious timeout and think about what they have been participating in and/or enabling. John Surratt’s 1870 speech — though of course it should be taken with a grain or two of salt — might help them wake up. (But it should have been obvious that between a kidnapping, hostage taking conspiracy and murder lay the thinnest of partitions. Trying to pretend or imagine otherwise is one of the most telling things about that historical case.)
kairosfocus, Surely you jest. If you think Elizabeth can be reasonable you must be joking. If you think any of our opponents wants a rational and well-reasoned discussion you are kidding yourself.
Their purpose is to obfuscate, not educate.
Mung @553 – that still leaves a lot, i.e. anything which isn’t totally deterministic. it also means rolling a die is, according to Ewert’s definition, a search. I think he’s stretching the definition a bit far.
Joe,
I am being forced into agreeing with you that there is a serious ideological agenda problem.
One that uncomfortably echoes my dealings with the Marxists years ago.
I suspect many of these have not got a clue the kind of matches they are playing with or how suddenly a fire they set can flash over into a devastating fire storm.
I have been there, had to live through a mini civil war. Saw agit-prop up close and personal, especially when I heard a glib spokeswoman excuse herself in inciting what triggered murder of an aunt. Saw how decades later people are all but impossible to extract from the propaganda stories of an awful time.
Saw it again in miniature on my uni campus with some of the same characters in action. I can never forget that incident of the student dragged out of a meeting by the ear after blurting out what should have woken people up. But, they would not listen, they were too wound up in a net of agit-prop fed hysteria. And it came to a head that awful day in Papine that could have spun out of control into something far, far worse than a teargas charge following a full auto volley of blanks. (I should mention, teargas grenades were fired INTO the crowd, never mind the clear labels not to do so. Yes, some were collected by students.)
Don’t ever underestimate situations that flash over into riotous assemblies and hysteria fueled mob rule.
I think I need to put up a warning on the dangers of indoctrination:
KF
Bob O’H: Dice rolling or the equivalent is often used in search type processes. Particularly when you want or are modelling a blind, random element. H’mm isn’t that used in part in immune system responses to try to catch a solution to some new infection? KF
Winston Ewert at EN&V
Wow! Talk about missing targets! How on Earth did ;insects find out how to fly? How did pterosaurs learn to fly? How did bats learn to fly? Design, of course! There can be no other explanation. So it has to be design.
Aurelio, You are confused, as usual. Yours cannot explain birds, nor insects. Get a grip and buy a vowel.
Given starting populations of prokaryotes yours doesn’t have a mechanism capable of getting beyond populations of prokaryotes. And you had to be given starting populations of prokaryotes because yours can’t even explain basic biological reproduction.
AS, sorry, but you are again setting up and knocking over already corrected strawmen. Birds, insects etc all exhibit FSCO/I in diverse ways connected with flight. They are highly contingent, complex and extremely functionally specific. With much associated information. On contingency, mechanical necessity does not explain the configs. On specificity plus complexity, chance is not a good explanation given the needle in haystack challenge. The only empirically warranted causal factor known to cause FSCO/I and passing the needle in haystack test is design. and if you want to pull the but they reproduce talking point, that too needs to be accounted for as rooted in FSCO/I. As Paley put on the table over 200 years ago. I suggest you take a look at 545 above: http://www.uncommondescent.com.....ent-561852 then onwards at 304:http://www.uncommondescent.com.....ent-561159 and then scroll down to 313. Repeating strawman arguments and outright false assertions in the face of easily accessible corrective information is less than acceptable. KF
Aurelio Smith asserted that there were no targets in evolutionary processes and asked me to provide evidence to the contrary. I offered the immune system.
I’m still waiting for a response Aurelio.
Aurelio is trolling. No surprise there.
Nowhere does Ewert make the claim attributed to him by Aurelio.
In fact, this brings to mind the following from Upright BiPed:
UB has a point. KF
mung writes:
That’s a very interesting subject and I’d love to explore it in detail together with you. You’re wrong to think that the immune system is “targeted”.
Ask the powers-that-be to unblock my home IP. A short comment appears eventually. A long comment just hangs. We could move discussion elsewhere, if you’re really interested in communication.
mung claims:
Oh, the irony!
Aurelio Smith: You’re wrong to think that the immune system is “targeted”.
Just for the record, since some people can’t be trusted to have total recall:
Aurelio Smith:
My response:
So I never said the immune system is targeted. Aurelio changed horses in midstream and went from claiming that evolution is not a search to issuing a challenge about evolutionary processes.
When asked to clarify his remarks, he didn’t.
When asked if the immune system was an evolutionary process, he had nothing to say.
So we’re still waiting. Nothing’s changed.
It’s pretty pointless to get into a debate about the immune system and targets if Aurelio can’t even say if it meets his definition of an evolutionary process and say why it meets his definition.
So the immune system doesn’t detect and then target invading substances? Really?
Mung has your number…
Quoting Upright BiPed’s comment reminded me, lol.
ok, so all other possible causes have been eliminated.
And that leaves?
The unthinkable.
The forbidden.
The impossible.
It’s not the logic that is the problem here, it is the illogical.
Only in internet debating forums would eliminating all other possible causes be considered a weakness of the method.
God help us if these people ever gain the power of the gun.
When you have eliminated the possible alternatives, whatever remains, however improbable, must be the truth.
Apologies to SH.
Joe: So the immune system doesn’t detect and then target invading substances?
Not if you’re an evolutionist. But maybe the immune system is not an evolutionary process. Maybe it’s designed. There’s always that.
The immune system is fascinating. There’s not much of a reason for it to exist if it has no purpose.
It’s not there to keep you alive, Joe, it’s just there to enhance your reproductive success. Never forget that.
Winston Ewert at EN&V says,
The target is effectively the measuring stick. The choice of target is arbitrary
I say,
This is fascinating to me. Do folks here agree with me that “Target” is effectively synonymous with “specification”.
If so this would reveal a connection between CSI and active information.
peace
peace
Mung,
You know the joke in all this?
Watch the default logic.
First, an aspect of an event, object, phenomenon etc is expected to reflect mechanically necessary order. Default no 1.
Broken if under closely similar initial conditions, quite divergent outcomes may occur. High contingency.
Second default: chance variability accounts for high contingency aspects. Willingly accepted, is a possible misattribution to chance leading to some sort of stochastically distributed range of outcomes.
Broken if, per a trillion item observational base, chance is overwhelmingly unlikely to achieve certain patterns reliably correlated with intelligently directed configuration. Such as, FSCO/I.
So in fact THERE IS A DEFAULT, DR WATSON.
Chance, not design.
This has been pointed out ever so many times and discussed that the insistence on falsely asserting design to be a default has to be willful.
Sad, but that is the level of talking point we are dealing with.
The answer to this is simple — used to be tried but after dozens of failures, the antics with semantics we now see more and more were resorted to. I guess about 4 years back.
What is it: simple, meet the vera causa test if you want to break the inference to design on high contingency and specificity-complexity: show a counter example that has chance [or whatever other factor one can come up with] generating FSCO/I on a reasonable basis.
Of course the many attempts we used to see foundered on being as a rule implicitly based on design.
Unsurprising.
KF
5th, the connexion is there at the outset, it takes specification + complexity to get an independently describable zone T in W that is beyond reasonable reach of blind, needle in haystack search. For relevant cases the specification is functional. If you look at the Marks, Dembsky et al papers, early on they speak to blind needle in haystack search. That’s what I pointed out within the 1st 2 dozen comments and refusal to face this is one of the strawman tactic points we are dealing with. KF
Meanwhile, Salvador feels more at home at TSZ:
Go for it Sal!
Elizabeth:
Mathematical proofs often make no sense and that’s why we ignore them. I’m with Elizabeth on this one!
Elizabeth Liddle @ TSZ:
We’d really like to believe that Elizabeth has seen the light, but given her past performances it’s just not likely.
This is a typical straw-man argument. She never identifies who has claimed that evolution is a search nor does she identify who has claimed that information is the same as [im]probability. She provides no quotes or references.
She’s preaching to the choir. A gaggle of sycophantic fanboys who dare not dispute her ignorant rantings lest they be excommunicated from the ranks of the faithful.
And then there’s the inevitable self-contradiction. The burqa that covers the faithful.
Just how many times here at UD has Elizabeth equated information with Shannon’s measure of information? Anyone?
EL,
They’ve over-thought the problem and come to a conclusion that appears mathematically valid, but actually makes no sense.
I say,
I find it quite telling that our materialist friends have taken the “Math is for geeks” approach to these issues. We see it with Dembski Marks and Ewert. We see it with Phil Maguire and even with Godel.
Don’t ever forget the math is on our side and the nerds always win in the end.
peace
Elizabeth @ TSZ:
There’s no such thing as an “Evolutionary Search” Elizabeth. You can’t add to something that does not exist. Why not just state it plainly so that no one is confused?
The way you phrase it, it’s as if something could be added to an evolutionary search, just not active information.
LoL! Sounds like evolution to me!
Notice how Elizabeth leaves herself an escape hatch.
Mung at 575, Sal is a strange bird. Years ago I respected him quite a bit, but now I don’t trust him much at all. Although he does have some good points, his conclusions don’t seem all that well thought out.
Never-the-less, what is the story behind him not posting on UD anymore? Did Mr. Arrington finally get tired of his less than forthright ways and quietly take away his OP posting privileges??
Elizabeth shows her desperation by throwing Dawkins under the bus:
Strange when it is obvious he knows more about evolution than she does. From Wikipedia:
Dawkins has been a leader of evolutionism since at least 1976 (selfish gene). He has influenced generations of biologists- he was an assistant professor of zoology, ie a biological science- Mayr was a zoologist.
And for some reason Tom English doesn’t think there was a generation of biologists raised on Dawkins. These people have no idea who he was and what he did. And that is hilarious.
ba77: I recently posed the question to Salvador. Does he still have his OP posting privileges here at UD, and if so does he just choose not to use them? He declined to answer.
Salvador’s no mystery. He’s looking for affirmation. If he can’t find it here he goes elsewhere.
It’s time the truth came out:
Sal Cordova is Elizabeth Liddle.
j/k folks
My head just exploded!
Elizabeth Liddle @16:
What on earth does this have to do with evolution, since evolution is not a search?
Sal’s just too busy with Creation Evolution University to post here anymore.
daveS,
But he finds time to post at TSZ.
Elizabeth Liddle @ TSZ:
LoL.
Joe Felsenstein @ TSZ:
JF (HT Mung, attn EL),
Pardon, but no.
The concern is not whether hill climbing can work incrementally to give local optimisation or some close cousin to that; which can legitimately be described as evolution and tracked to correlate with the actually empirically observed case: microevolution. That hill climbing approach, we all learned in our first calculus course as we seek maxima, minima and points of inflexion.
The issue at stake is that for systems exhibiting a certain character, functionally specific complex interactive Wicken wiring diagram based organisation and associated information FSCO/I for short . . . the material subset of CSI . . . the requisites of interaction that yields particular function call for correctly arranged and coupled, well matched parts. Thus we are locked down to a narrow zone or zones Ti ( i = 1 to n as usual) in the much wider set of possible clumped and/or scattered arrangements constituting the configuration space W. Where Ti is such that length of the string of structured y/n q’s to describe configs exhibiting FSCO/I is at least 500 – 1,000 bits, i.e. 72 – 143 ASCII characters. Not a lot. This is directly tied to Kolmogorov complexity. For practical cases think AutoCAD etc.
This is what sets up the needle in haystack search challenge that Marks, Dembski et al have consistently pointed to as the setting for active, bridging information. The body plan origin challenge, starting with the first one at the root of Darwin’s tree of life.
In effect, AI is the bridge between the practical infeasibility of blindly finding a Ti in W, and the location on or next to a Ti that sets up hill climbing through a much narrower incremental scope of search. In an Easter Egg hunt, warmer/colder allows ascent to an optimum, and the like. Designers of complex systems typically use insight to set up a near-feasible system, then do development testing and troubleshooting to incrementally achieve local then interface then systemwide reliable and adequate functionality.
So the focal problem is that informational bridge.
It cannot feasibly be crossed incrementally, as there is no feedback from increments in functionality in the vast zone of non-function. And sol system or observed cosmos scope resources across 10^17 s as generally deemed available, are hopelessly short of more than superficial search. 500 – 1,000 bits worth of config space is 3.27*10^150 – 1.07*10^301 possibilities. At the upper end, at 10^14 tries per second with 10^80 atoms as observers the 10^111 tries in aggregate viewed as one straw would be compared to a cubical haystack that dwarfs our observed cosmos.
The only actually empirically warranted adequate cause of crossing such a bridge is intelligently directed configuration. On trillions of cases all around, starting with nuts and bolts, gear trains and web pages.
And as for metrics of AI, a search is a sampled subset of the config space of scope W. Therefore, it comes from the set of subsets, of cardinality 2^W. Accordingly, in the context of needle in haystack challenge it is reasonable to take a flat random sample as a yardstick, typical blind search. A blindly picked, superior bridging search confronts the problem of search for a golden search in that much wider space and so direct search is reasonable as a typical case. Thus, out-performance of flat random search is a good metric of injected, bridging active information that guides configuration to [near-]functional form. For the likelihood of success has been drastically improved relative to benchmark.
Begging the bridging question, then, does not adequately answer it.
Suggesting that technological systems do not reproduce but life forms do, begs the question of where the FSCO/I involved in cellular replication and organism level reproduction comes from. As Paley put on the table in 1804 with his Ch 2 elaboration of the watch found in the field in Ch 1 of his Nat Theol: what would be the effect of observing that in the course of its movement, the watch replicates itself using a process that is FSCO/I-rich. The added integrated FSCO/I to effect this, multiplies the bridging challenge. In effect the original entity now comes with a built-in factory with assembly instructions.
Thus, the root of Darwin’s Tree of Life icon (ToL) must be answered to, in Darwin’s pond or the like; to get to a gated, encapsulated metabolic automaton with an integral von Neumann kinematic self replicator with part synthesis and assembly instructions codes and algorithms. Likewise, embryologically feasible, ecological niche survivable body plans have to be addressed for OO body plans (OOBP). Dozens of times over.
I repeat, the only empirically warranted adequate cause of FSCO/I is design; intelligently directed configuration that bridges the information gap to solve the blind search needle in haystack challenge. Something you and I demonstrate every time we compose a complex comment. Something the computers we use further demonstrate.
Something we have no good reason to see OOL or OOBP evading.
I also notice from excerpts, that some are objecting to negative probability metrics (and presumably directly linked config alternative count) metrics of information.
Information rests on distinct and recognisable states amidst alternatives that can represent or reflect or describe states of affairs or guide actions from sets of alternatives. Its basic level is the two state alternative, the binary digit or bit.
The simplest alternative.
A simple flat random alternative for a string of bits of length n will show that number of possibilities for n bits is 2^n. This invites a log measure of info, as that gives additive properties. Instead of 2^(m + n) states, we discuss m + n bits. Such is of course the common info metric on file sizes, which de facto uses Bernoulli indifference to estimate info carrying capacity of files on a PC. The log metric turns out to be readily linked to a log(1/p), probability metric, yielding negative log probability.
More complex versions may be developed for cases where a flat distribution of state configs is not applicable (based on weighted average techniques), but this does not materially change the case. Cf comment 5 above for a clip on this preliminary matter — one of those swept away by AS which turns out to be just as advertised; foundational background required to think the matter through clearly.
In short, for the better part of a century, information and surprising configuration from a set of alternatives, thus also [im-]probability have been inextricably linked in the foundations of communication theory. This obviously extends to the informational content of FSCO/I and the bridge from what a reasonable blind random search/sample process would credibly do and hitting zones Ti. Thus active, bridging information is a reasonable concept, and it is not unreasonable to measure it based on its capability to bridge an info gap.
Mathematical elaborations are important, but they are just that, elaborations.
We must not lose sight of the forest due to a tangled mass of trees.
The issue is not hill climbing within an island of function but to bridge to such islands Ti in the face of a much wider but overwhelmingly non functional set of clumped or scattered configurational possibilities, W. Where the situation confronts blind search approaches on sol system or observed cosmos gamuts with a needle in haystack challenge. Thus, the issue of bridging, active information that finds Ti is on the table.
And, appeals to self replication and/or reproduction must address origin of such FSCO/I rich processes integrated with functionality of life forms.
I must strongly insist, the only actually observed, empirically warranted adequate causal factor that explains cases of FSCO/I is intelligently directed configuration, AKA design.
So, we are inductively entitled to infer with some confidence from FSCO/I to design as material causal factor; with the usual inductive proviso that thus is best current explanation. However, the circumstances over the past few thousand years of thought on the matter make it highly unlikely that this will be overturned. Design is the only truly serious, empirically warranted adequate cause of FSCO/I. Precisely, because of the need for bridging information that reflects the blind needle in haystack search challenge.
KF
Too funny- Mung has the TSZ ilk admitting that their brand of evolution is impotent and they are too dim to realize it.
More hilarity from TSZ- They cannot figure out how their brand of evolution is impotent. It isn’t a search. It is whatever happens. Some of whatever happens gets eliminated and some doesn’t. Whatever happens to survive and reproduce does so.
It’s a whole bunch of whatever happens and happens to survive. That can’t even produce the different breeds of dogs which is much easier than macroevolution. And that is the impotence of their process.
And if they ever find a way to model it they will have the “proof” that I am correct.
For a good laugh just read Alan Fox’s post filled of nonsensical bald declarations:
Alan’s evidence-free diatribe- The environment is the guide and the designer? Test it, Alan. Show us that the environment can guide and design wrt biology. Model it- do something but keep saying your oft-refuted drool.
Elizabeth thinks that evolution and Intelligent Design are mutually exclusive:
She is a grand equivocator. She actually thinks that humans using GAs to find solutions, ie design, means that evolution did it and not the designers of the program.
How misguided can she be?
Joe, you are right, the contrast made indicates a telling gap on say familiarity with the view of the co-founder of the modern evolutionary theory, Wallace — as has been repeatedly pointed out here at UD, titled
The World of Life: a manifestation of Creative Power, Directive Mind and Ultimate Purpose
Kind of could not be clearer or more direct.
Preface:
What is mutually contradictory is design and evolutionary materialism. But that is a philosophy, not science, at its root. And, as has been highlighted over and over on good reason, a self-falsifying, self referentially incoherent one.
For example, here is J B S Haldane:
Of course, all of this ha been repeatedly pointed out and never cogently responded to.
The evidence points to an entrenched ideological position, one that will only be opened up to change when things crash so undeniably that there is no choice. As happened with the Marxists 25 years past.
KF
kairosfocus: The brain IS composed of atoms. That is undeniable.
How best to describe a mind is something else.
I am trying to do just that by building a software architecture to model large systems such as ID and evolution.
Hopefully I can pick up enough from the ID side to try and come up with a system that will allow the ID side to design towards a known biological goal.
Joe:
That is precisely what I am going to attempt to do. It would be great to be able to model both ID and evolutionary solutions to body plans and see which results in a better fit for a given environment.
Carpathian,
Neither I nor J B S Haldane ever suggested that the human brain is not composed of atoms.
What HALDANE raised is a key issue that points to the self referential incoherence of reducing mind to brain and effectively software running on it.
The reductionist project, especially in computing terms, can be challenged i/l/o this, from Reppert:
My own comment is that computation, inherently is categorically distinct from rational contemplation, and to try to derive the latter from the former is to try to get North by heading due West.
KF
BTW, I should note that if islands of function are as shape and location shifting as sand dunes/spits/ barrier islands does not make a material difference to the information bridge challenge. KF
Carpathian, Evolutionary and genetic algorithms already model Intelligent Design evolution. How do you propose to model unguided evolution?
Joe, didn’t Elizabeth design a program to show that natural selection could create CSI?
Doesn’t that just prove that evolution is intelligently designed?
Well, Mung, she sed that she did such a thing but in reality it didn’t come close. She doesn’t seem to understand the concept of CSI.
Neil Rickert finally gets it:
Darwinian and neo-Darwinian (modern synthesis) evolution preclude intention meaning natural selection precludes intention. Once you have intention you have left Darwinian and neo-Darwinian evolution behind and have entered the realm of Intelligent Design Evolution.
Don’t get your hopes up Joe.
Well Joe, we’re going to have to disagree on this. She understood CSI, but she didn’t understand evolution.
Meanwhile, over at TSZ Joe Felsenstein claims to have an answer. But he seems to be groping for where it is.
I wrote:
Mike:
Again, Stonehenge does not self replicate. It does not contain the knowledge of how to copy itself. As such, the knowledge of what transformations would be necessary to build it must be explained by knowledge outside of Stonehenge. Correct?
On the other hand, organisms do self replicate and do contain the knowledge of how to build a copies of themselves. The concrete features they exhibit are adaptations brought about by transformations of matter. So, the origin of those features is the origin of the knowledge of what transformations to perform. Saying that knowledge was merely previously located one place (in an abstract designer) and copied to another (in an organism), doesn’t actually add to the explanation for those concrete features.. Unless you explain why that concert knowledge is what it is, opposed to some other concrete knowledge that could have been there, you’ve explained nothing. The proximate cause is that knowledge, As such, we need not reference an external source.
At best, the current crop of ID proponents can say “that’s just what the designer must have wanted”, which doesn’t explain anything. So, ID doesn’t actually explain those concrete features, while Darwinism does. And it did so before the discovery of DNA. That discovery is part of the significant criticism that Darwinism has withstood.
Furthermore, as Popper pointed out, ‘good’ theories make prohibitions. The more a theory prohibits, the better. However, ID’s designer is abstract and has no defined limitations. As such, there is no limitation as to what the designer knew, when it knew it, etc. that would have logical consequences for the current state of the biosphere. By nature of being able to explain anything, it explains nothing.
For example, ID’s designer, not being limited from knowing how to build any organism that has, does or will exist, at the outset, could have created organisms in the order of most complex to least complex, or even all at once.
In contrast to Lamarckism or the current crop of ID, Darwinism has always been the theory that the knowledge of how what adaptations to perform was genuinely created over time. It never existed at the outset. This has corresponding consequences for the current state of the system. Namely, that organisms would appear in the order of least complex to most complex. Nature cannot “construct” until it creates the knowledge of how to build it. And by knowledge, I mean in Popper’s definition of useful information that is independent of a knowing subject, as outlined in Objective Knowledge.
Popperian,
How many times do I have to point you to where Paley took his watch example next, and what this highlights about the FSCO/I involved in a self-replication facility?
I really have to ask this.
Let me clip again, for information:
>> Suppose, in the next place, that the person who found the watch should after some time discover that, in addition to all the properties which he had hitherto observed in it, it possessed the unexpected property of producing in the course of its movement another watch like itself — the thing is conceivable; that it contained within it a mechanism, a system of parts — a mold, for instance, or a complex adjustment of lathes, baffles, and other tools — evidently and separately calculated for this purpose [==> update, vNSR, with tape [a bar of cams is a program, as was used in so many C18 automata], and constructor keyed in as an ADDITIONAL facility integrated with the main machine — of course, IIRC a full size clanking unit considered by NASA was many, many tons in scale] . . . .
The first effect would be to increase his admiration of the contrivance, and his conviction of the consummate skill of the contriver. Whether he regarded the object of the contrivance, the distinct apparatus, the intricate, yet in many parts intelligible mechanism by which it was carried on, he would perceive in this new observation nothing but an additional reason for doing what he had already done — for referring the construction of the watch to design and to supreme art [--> notice, the impact of seeing ADDITIONAL FSCO/I] . . . . He would reflect, that though the watch before him were, in some sense, the maker of the watch, which, was fabricated in the course of its movements, yet it was in a very different sense from that in which a carpenter, for instance, is the maker of a chair — the author of its contrivance, the cause of the relation of its parts to their use. >>
I trust the flawed analogy flawed objection and associated strawman caricatures dating all the way back to Paley will now be retired.
KF
Joe
Again, neo-Darwinsm is the theory that the knowledge of what transformations to perform when making a copy of an organism was not already preset at the outset. Since the concrete features of an organism are a function of that knowledge, as opposed to some other knowledge, the origin of those features is the origin of that knowledge.
In addition,intention simply isn’t enough.
For example, I’d like to create a drug that will cure cancer. However, regardless of my Intentions, this would only occur if i possessed the knowledge of what transformations are needed to occur via drug interactions that would cure cancer. I do not possess this knowledge. Nor do I even know where to start with creating any kind of drug, in general, which would preclude me from accentually discovering a cure when trying to solve some other illness by drug related means.
So, regardless of my desire, I cannot create any such drug. Intention simply isn’t enough.
Furthermore, we’ve made progress in the field of epistemology. Specially, there are two kinds of knowledge: explanatory knowledge and non-explanatory knowledge. Both biological replicators and people can create knowledge of the former kind, while only people can create knowledge of the latter.
Explanatory knowledge is created when we conjecture a theory about how the world works that we think will solve a specific problem.
Finally, you seem to be assuming that ID’s designer is just like us, but smarter. However, that isn’t explicitly part of intelligent design theory. Nor is it clear why that would be the case. It wouldn’t have anything to do with scripture, would it? In the absence of such an assumption, we cannot know what any such designers’ intentions might be, including making things appear as if they evolved naturally. That could be an intentional result too, right?
Again, a theory that could explain anything explains nothing.
Even then, there could be an entire committee of designers that do not agree with each other, resulting in a compromise that no one wants. Or there could be two equally powerful, yet completely opposed designers that are stuck in some kind of battle in which neither has won. In other words, even if these designers possessed the knowledge, intent simply isn’t enough to guarantee the result would be intuitional outcomes.
It’s unclear why these logical possibilities are not taken into account, unless the designer is supposedly an ultimate designer. But, again, this results in the same problem I’ve mentioned before. Any such ultimate designer would itself be well adapted for the purpose of designing organism. As such, it too would equally qualify for the need of a designer, etc.
The claim that we must stop somewhere is justifcationism and results in an arbitrary end of the application of reason.
Popperian:
Please reference this theory so we can all read what it actually says. And then try to respond to what I wrote
Not where you are concerned, anyway.
So what?
So what? ID doesn’t prevent me from doing so.
What does that mean? Design is natural, not supernatural. Intelligent Design Evolution would be natural. It just wouldn’t be unguided.
True and ID doesn’t even attempt to explain everything.
But anyway to rid us of Intelligent design just give us a viable alternative sans Intelligent Designer. Start with a model and testable entailments.
Popperian:
Self-replication is the very thing that requires an explanation. That means Stonehenge is orders of magnitude less specified and complex than a living organism.